View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_113 (Length: 268)
Name: NF0622_low_113
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_113 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 30 - 268
Target Start/End: Original strand, 31622918 - 31623156
Alignment:
| Q |
30 |
ggaagtagctccagaagcgagggggacagtgggagaagacgcggttggcttcgtgaagaagaaccggcagaaaccgcggggcgccgctaccgctgcagcc |
129 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31622918 |
ggaagtaactccagaagaaagggggacagtgggagaagacgcggttggcttcgtgcagaagaaccggcagaaaccgcggggcgccgctaccgctgcagcc |
31623017 |
T |
 |
| Q |
130 |
ctcatcgtcaaagccaaagcagccacgggtttaagctaaaatgtaaaaccctttcgttggttgaaggagacgttgagagaagaaagaattgttccttcgc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31623018 |
ctcatcgtcaaagccaaagcagccacgggtttaagctaaaatgtaaaacgctttcgtgggttgaaggagacgttgagagaagaaagaattgttccttcgc |
31623117 |
T |
 |
| Q |
230 |
ttaatttcaactctcgaagctcaaaagtgataatcactt |
268 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31623118 |
ttaatttcaactctcaaagctcaaaagtgataatcactt |
31623156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University