View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_127 (Length: 251)
Name: NF0622_low_127
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_127 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 39154878 - 39154990
Alignment:
| Q |
139 |
aagaaaaagactcttgcaaaaacatgttcataatatttgaaatttactatatgcaggtctctgatgagtgcactaccaaatctggcttccatattagagg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39154878 |
aagaaaaagactcttgcaaaaacatgttcataatatttgaaatttactatatgcaggtctctgatgagtgcactaccaaatctggcttccatattagagg |
39154977 |
T |
|
| Q |
239 |
cgacaatagcagc |
251 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39154978 |
cgacaatagcagc |
39154990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 14 - 86
Target Start/End: Original strand, 39154752 - 39154824
Alignment:
| Q |
14 |
aggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttccgcc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39154752 |
aggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttccgcc |
39154824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 29125595 - 29125662
Alignment:
| Q |
15 |
ggagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggattgtgagtatcttc |
82 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29125595 |
ggagaaaagggtggccaagtgttttgtgctgaaatatgtattatttggagaggattgtaagtatcttc |
29125662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 32743391 - 32743337
Alignment:
| Q |
16 |
gagaaaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggatt |
70 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
32743391 |
gagaaaagggtggcaatgtgttttgtgctgaaatatgtattatctggagaggatt |
32743337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 29125802 - 29125843
Alignment:
| Q |
186 |
tatatgcaggtctctgatgagtgcactaccaaatctggcttc |
227 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
29125802 |
tatatgcaggtctctgatgagtgcaccactaaatctagcttc |
29125843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 50 times since January 2019
Visitors: 3832