View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_131 (Length: 250)
Name: NF0622_low_131
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_131 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 101 - 242
Target Start/End: Complemental strand, 37058399 - 37058258
Alignment:
| Q |
101 |
aaaggttaattatttccaattgatcaaggggaatgtagaaaaaaccatgaagcatattaaattttttgggtataaaagtatttccgacagacaatgtata |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058399 |
aaaggttaattatttccaattcatcaaggggaatgtagaaaaaaccatgaagcatattaaaatttttgggtataaaagtatttccgacagacaatgtata |
37058300 |
T |
|
| Q |
201 |
ttttgcataggattctcactattttttctcttcacccctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058299 |
ttttgcataggattctcactattttttctcttcacccctttg |
37058258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 37058492 - 37058419
Alignment:
| Q |
1 |
aaagataaggtgagacttaagttatccttcgatgtagtttaccccaatgataaataaaaatgaagaaaaagaga |
74 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058492 |
aaagataaggtgagacttacgttacccttcgatgtagtttaccccaatgataaataaaaatgaagaaaaagaga |
37058419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2330 times since January 2019
Visitors: 3818