View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_133 (Length: 245)
Name: NF0622_low_133
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_133 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 29 - 244
Target Start/End: Complemental strand, 3124264 - 3124048
Alignment:
| Q |
29 |
caatgatttgaagcacattgtgaattttcgatttt-catataaattactaacttaaaattttgttacttgcaaacagacaacggttataaaacaatatac |
127 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||| |||||||||||||||| |||||||||||| | ||||||||||| || || |||||| ||||| | |
|
|
| T |
3124264 |
caatgatttgaggcacattgtgaatttccggtttttcatataaattactaacataaaattttgttccatgcaaacagactacagtcataaaagaatatcc |
3124165 |
T |
 |
| Q |
128 |
agcagagattattgtggtatttttatgcaacctatgtggattactagtgtctgtaccaaaatgcttactactagaaccaaacttgagtgcttggaagata |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| ||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3124164 |
agcagagattattgtggtatttttatacaacttatgtggagtactagtatctataccaatatgcttactactagaaccaaacttgagtgcttggaagata |
3124065 |
T |
 |
| Q |
228 |
aatcttgatataacaat |
244 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
3124064 |
aatcctgatataacaat |
3124048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 24 - 92
Target Start/End: Original strand, 3557614 - 3557680
Alignment:
| Q |
24 |
ctaagcaatgatttgaagcacattgtgaattttcgattttcatataaattactaacttaaaattttgtt |
92 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3557614 |
ctaagcaatgatttgaagcacattatgaattttcga--ttcatataaattactaacttaaaattttgtt |
3557680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University