View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_134 (Length: 244)
Name: NF0622_low_134
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_134 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40084756 - 40084515
Alignment:
Q |
1 |
ttccaaccgttgatcttagctttaaccggttatctggtcaaatatcacctatgctggccaatgtgcagaatctttacctgaataacaaccggttcacggg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40084756 |
ttccaaccgttgatcttagctttaaccggttatctggtcaaatatcacctatgctggccaatgtgcagaatctttacctgaataacaaccggttcacggg |
40084657 |
T |
 |
Q |
101 |
tcgggtaccggctagttttgtggagcggttattggatgcaagcatacagatattatatttgcagcataattatttaactggaattgagattagtccaacg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40084656 |
tcgggtaccggctagttttgtggagcggttattggatgcaagcatacagatattatatttgcagcataattatttaactggaattgagattagtccaacg |
40084557 |
T |
 |
Q |
201 |
gctgtaattccagagagaagttcactgtgtatgcagtataat |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40084556 |
gctgtaattccagagagaagttcactgtgtatgcagtataat |
40084515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 37408148 - 37408096
Alignment:
Q |
150 |
atattatatttgcagcataattatttaactggaattgagattagtccaacggc |
202 |
Q |
|
|
|||||||||||||||||||||||| | || ||||| | ||||| ||||||||| |
|
|
T |
37408148 |
atattatatttgcagcataattatctcaccggaatcgtgattaatccaacggc |
37408096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2631 times since January 2019
Visitors: 3822