View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_142 (Length: 215)
Name: NF0622_low_142
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_142 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 32206209 - 32206005
Alignment:
Q |
1 |
tgatactgttcgcgcttactcatttggagttctatactttgtagaggtatgtatccaaaacttaaatcactttctagtactactaactctaaaattgtaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32206209 |
tgatactgttcgcgcttactcatttggagttctatacttcgtagaggtatgtatccaaa-cttaaatcactttctagtactactaactctaaaattgtaa |
32206111 |
T |
 |
Q |
101 |
atcggtaacctcaattttatgtatgatatgatataacttttcaattgtaaaacaggttgacattgaactgccagaggatttacccttaaaagaagcacat |
200 |
Q |
|
|
||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32206110 |
atctgtaacctcaattttatgtatgatat-----aacttttcaattgtaaaacaggttgacattgaactgccagaggatttacccttaaaagaagcacat |
32206016 |
T |
 |
Q |
201 |
attcttggaga |
211 |
Q |
|
|
|| ||||||| |
|
|
T |
32206015 |
atcattggaga |
32206005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 28294531 - 28294484
Alignment:
Q |
153 |
caggttgacattgaactgccagaggatttacccttaaaagaagcacat |
200 |
Q |
|
|
||||| |||||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
28294531 |
caggtagacattgaactgccagaggaattaccattaaaagaagcacat |
28294484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University