View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_low_142 (Length: 215)

Name: NF0622_low_142
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_low_142
NF0622_low_142
[»] chr5 (1 HSPs)
chr5 (1-211)||(32206005-32206209)
[»] chr3 (1 HSPs)
chr3 (153-200)||(28294484-28294531)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 32206209 - 32206005
Alignment:
1 tgatactgttcgcgcttactcatttggagttctatactttgtagaggtatgtatccaaaacttaaatcactttctagtactactaactctaaaattgtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
32206209 tgatactgttcgcgcttactcatttggagttctatacttcgtagaggtatgtatccaaa-cttaaatcactttctagtactactaactctaaaattgtaa 32206111  T
101 atcggtaacctcaattttatgtatgatatgatataacttttcaattgtaaaacaggttgacattgaactgccagaggatttacccttaaaagaagcacat 200  Q
    ||| |||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32206110 atctgtaacctcaattttatgtatgatat-----aacttttcaattgtaaaacaggttgacattgaactgccagaggatttacccttaaaagaagcacat 32206016  T
201 attcttggaga 211  Q
    ||  |||||||    
32206015 atcattggaga 32206005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 28294531 - 28294484
Alignment:
153 caggttgacattgaactgccagaggatttacccttaaaagaagcacat 200  Q
    ||||| |||||||||||||||||||| ||||| |||||||||||||||    
28294531 caggtagacattgaactgccagaggaattaccattaaaagaagcacat 28294484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2022 times since January 2019
Visitors: 3811