View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_147 (Length: 203)
Name: NF0622_low_147
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_147 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 19896438 - 19896344
Alignment:
Q |
1 |
gagtatcacctctttcagtctttatttcaaaaccactttgatcattatgcttctttactattacatctacaagacgttttacaatgtcttcgttg |
95 |
Q |
|
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19896438 |
gagtatcacctttttcagtctttatttccaaaccactttgatcattatgcttctttactattacatctacaagacgttttacaatgtcttcgttg |
19896344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 20123380 - 20123489
Alignment:
Q |
1 |
gagtatcacctctttcagtctttatttcaaaaccactttgatcattatgcttctttactattacatctacaagacgttttacaatgtcttcgttgtcaat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||||| || | |
|
|
T |
20123380 |
gagtatcacctctttcagtctttatttcaaaaccactttgatcatcatg---ctttactattgcatctacaagacgttttacactgtcttcgttggcatt |
20123476 |
T |
 |
Q |
101 |
gcttattgccaca |
113 |
Q |
|
|
||||| ||||||| |
|
|
T |
20123477 |
gcttactgccaca |
20123489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 20089524 - 20089615
Alignment:
Q |
1 |
gagtatcacctctttcagtctttatttcaaaaccactttgatcattatgcttctttactattacatctacaagacgttttacaatgtcttcgttg |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
20089524 |
gagtatcacctctttcagtctttatttcaaaaccactttgatcatcatg---ctttactattgcatctacaagacgttttacaatgtcttcgttg |
20089615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2626 times since January 2019
Visitors: 3822