View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_149 (Length: 202)
Name: NF0622_low_149
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 53592605 - 53592502
Alignment:
Q |
1 |
gatgacaagaagaaagatgtttgtttgatattatcttttagaaggaagcatataggaaacacgcgatacaaccttacttgcattgctgttctcttcaagt |
100 |
Q |
|
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
53592605 |
gatgacaataagaaagatgtttgtttgattttatcttt--gaaggaagcatataggaaacacgcgatacaaccttacttgcattgttgttctcttcaagt |
53592508 |
T |
 |
Q |
101 |
agttgg |
106 |
Q |
|
|
|||||| |
|
|
T |
53592507 |
agttgg |
53592502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2349 times since January 2019
Visitors: 3818