View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_low_150 (Length: 202)

Name: NF0622_low_150
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_low_150
NF0622_low_150
[»] chr4 (1 HSPs)
chr4 (1-116)||(53592581-53592696)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 53592581 - 53592696
Alignment:
1 aacaaacatctttcttcttgtcatctactttttccaatttcctgcaaacaataaaaattggattgatcacttacaagttacaacaaacaaaagtatatca 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
53592581 aacaaacatctttcttattgtcatctactttttccaatttcctgcaaacaataaaaattggattgatcacttacaagttacaacaaacaaaagtacatca 53592680  T
101 agagtagttgggttgg 116  Q
    ||||||||| ||||||    
53592681 agagtagttaggttgg 53592696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2735 times since January 2019
Visitors: 3823