View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_low_27 (Length: 554)

Name: NF0622_low_27
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_low_27
NF0622_low_27
[»] chr7 (2 HSPs)
chr7 (188-287)||(3870103-3870202)
chr7 (316-384)||(3870032-3870100)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 2e-44; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 188 - 287
Target Start/End: Complemental strand, 3870202 - 3870103
Alignment:
188 tttagggagtaaatatatcgagaaatttattttaggcaaaattgttttttgaagagaaactctacgaaactaagagtgcaagtcgtccctttagcacaaa 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||    
3870202 tttagggagtaaatatatcgagaaatttattttaggcaaaattgttttttgaagagaaactctatgaaactaagagtgcaagtcatccctttagcacaaa 3870103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 316 - 384
Target Start/End: Complemental strand, 3870100 - 3870032
Alignment:
316 tgaactattaagaatgaaaaataaatctggtttaactcatctaatgcatcatttgctcaagtttaatcg 384  Q
    ||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||    
3870100 tgaactattaaaaatgaaacataactctggtttaactcatctaatgcatcatttgctcaagtttaatcg 3870032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2566 times since January 2019
Visitors: 3822