View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_36 (Length: 514)
Name: NF0622_low_36
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 183 - 400
Target Start/End: Original strand, 31643186 - 31643403
Alignment:
| Q |
183 |
gtgttagccctccggttcggttagaatataagttaagcatgtcagaggattgtaccatccagaaatcgaactcattattctcttctttattatctggttc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643186 |
gtgttagccctccggttcggttagaatataagttaagcatgtcaaaggattgtaccatccgggaatcgaactcattattctcttctttattatctggttc |
31643285 |
T |
 |
| Q |
283 |
ttccttaatttcaaccggatgtgaattttcttgttgaagcgccttctcataaggaccgagttgttcgcccatactactaccaatgtcggtactagccaac |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643286 |
ttccttaatttcaaccagatgtgaattttcttgttgaagcgccttctcataatgaccgagttgttcgcccatactactaccaatgtcggtactagccaac |
31643385 |
T |
 |
| Q |
383 |
tgcgatgaaggtgaatgg |
400 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
31643386 |
tgtgatgaaggtgaatgg |
31643403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 83 - 135
Target Start/End: Original strand, 31643083 - 31643135
Alignment:
| Q |
83 |
gaataatatgtctggtaagctttcaccatctctaaaagagggacagaggcatg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31643083 |
gaataatatgtctggtaagctttcaccatctctaaaagaggggcagaggcatg |
31643135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University