View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_41 (Length: 479)
Name: NF0622_low_41
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_41 |
 |  |
|
[»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 259 - 479
Target Start/End: Complemental strand, 47999742 - 47999522
Alignment:
Q |
259 |
tctggtttgatgttttgggttggctttcatctcccattggaagcattcattaacccttaaaggtttacgttgatattttgtccaatgatctttaggattg |
358 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47999742 |
tctggtttgatgttttgggttggctttcatctcccattggaagcattcattaacccttaaaggtttacgttgatattttgtccaatgatctttaggattg |
47999643 |
T |
 |
Q |
359 |
gtttcataccacttttggtttagtttggcatttacaattcgcttttgggatgactctagtacttttgtgttgttttattgggtaccttgctattctcttt |
458 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47999642 |
gtttcataccacttttggtttagtttggcatttgcaattcgcttttgggatgactctagtacttttgtgttgttttattgggtaccttgctattctcttt |
47999543 |
T |
 |
Q |
459 |
ttattttacttcaaaaataat |
479 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
47999542 |
ttattttacttcaaaaataat |
47999522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 144 - 209
Target Start/End: Complemental strand, 47999805 - 47999741
Alignment:
Q |
144 |
tttgagccttaagttaattgatggatttccgtcactttgttgtttcattgccataggtttttgttc |
209 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
T |
47999805 |
tttgacccttaagttaattgatggatttc-gtcactttgttgtttcattaccataggttttcgttc |
47999741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 47999885 - 47999844
Alignment:
Q |
97 |
atgaggtcattcaaatagtcgctagcgacaacaaagtggact |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47999885 |
atgaggtcattcaaatagtcgctagcgacaacaaagtggact |
47999844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University