View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_64 (Length: 407)
Name: NF0622_low_64
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 79 - 393
Target Start/End: Complemental strand, 16697991 - 16697678
Alignment:
Q |
79 |
aacaccggcaagaatctgtctccttttgataaaagcatattgaacatgtgagacaacaatactgccaatgacaaggtgcagtctattagttaggaccttt |
178 |
Q |
|
|
||||||||||||||| ||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||| | |||||||||| |||||||||| |
|
|
T |
16697991 |
aacaccggcaagaatatgtctccctttgataaaagcagattgaacatgtgaggcaacaatactgccaatgacaaggcgtagtctattagctaggaccttt |
16697892 |
T |
 |
Q |
179 |
gccaacactttgtacatgcaacctactagagaaatggggcgaaagtggttaaggtgttgaggactatgcacctttgaaattagagctataaaggttgtat |
278 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| || |
|
|
T |
16697891 |
gccaacactttgtacatgcaacctactagagaaatgaggcgaaagtggttaaggtgttgaggattatccacctttgaaattagagctataaaggttgcat |
16697792 |
T |
 |
Q |
279 |
tgattccttttgaaaacttcctgttgtgatgaaattcagataaaaatcgcatgaaatctatccaaagttcgttccaaaactcttttatgaaaccaaaact |
378 |
Q |
|
|
| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
T |
16697791 |
t-attccttttgaaaacttcccgttgtggtgaaattcagataaaaatcgcatgaaatctacctgaagttcgttccaaaaatcttttatgaaaccaaaact |
16697693 |
T |
 |
Q |
379 |
gatgtcatttggatc |
393 |
Q |
|
|
||||||||||||||| |
|
|
T |
16697692 |
gatgtcatttggatc |
16697678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 291 times since January 2019
Visitors: 3833