View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_85 (Length: 322)
Name: NF0622_low_85
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_85 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 91 - 301
Target Start/End: Original strand, 5416290 - 5416500
Alignment:
| Q |
91 |
ctttcatattttgagatctttgaatatttgtattaattgttaatacacggttggtttctgcttagtttatgattttgtttcatgctatacaaagaatata |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416290 |
ctttcatattttgagatctttgaatatttgtattaattgttaatgcacggttggtttctgcttagtttatgattttgtttcatgctatacaaagaatata |
5416389 |
T |
|
| Q |
191 |
agaagaagaccccacagaaggttatgattgttattgcaagggcatgattgttgttgtaacacattagattttggnnnnnnnttcatcttttttcctttaa |
290 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
5416390 |
agaagaagaccccactgaaggttatgattgttattgcaagggcatgattgttgttgtaacacattagattttggcccccccttcatcccttttcctttaa |
5416489 |
T |
|
| Q |
291 |
ttctttggcaa |
301 |
Q |
| |
|
||||||||||| |
|
|
| T |
5416490 |
ttctttggcaa |
5416500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 5435351 - 5435415
Alignment:
| Q |
114 |
atatttgtattaattgttaatacacggttggtttctgcttagtttatgattttgtttcatgctata |
179 |
Q |
| |
|
|||||| |||||| | |||| ||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5435351 |
atatttatattaaccgctaatgcacggttggtttctgcttagtttatga-tttgtttcatcctata |
5435415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2534 times since January 2019
Visitors: 3822