View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_89 (Length: 308)
Name: NF0622_low_89
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 102 - 245
Target Start/End: Complemental strand, 2467908 - 2467765
Alignment:
| Q |
102 |
ttgaattgaatgaaatgaagttgaagataggttcaggaaattaccgctgtagcccggaaaatgttggtgaattgaaagcgtggtggtaatttgagattgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467908 |
ttgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagaccgaaaaatgttggtgaattgaaagcgtggtggtaatttgagattgc |
2467809 |
T |
|
| Q |
202 |
agcgaggagtaggaggggggaaaatggaagaggatataagtgag |
245 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2467808 |
agcgaggagtaggagggggaaaaatggaagaggatataagtgag |
2467765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 32 - 93
Target Start/End: Complemental strand, 2468028 - 2467967
Alignment:
| Q |
32 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468028 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacag |
2467967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2834 times since January 2019
Visitors: 3829