View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_91 (Length: 304)
Name: NF0622_low_91
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_91 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 89 - 219
Target Start/End: Original strand, 46107748 - 46107878
Alignment:
| Q |
89 |
acatcatcaattttgatttaaaggcacagccgccagaagtaaggacaatgacagtctcattcccgaacactctcccaaaagccctgcatcacgtggaatc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46107748 |
acatcatcaattttgatttaaaggcacagccgccagaagtaaggacaatgacagtctcattcccgaacactctcccaaaagccctgcatcacgtggaatc |
46107847 |
T |
 |
| Q |
189 |
cttttgttgttcgttctgccatccctagcac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46107848 |
cttttgttgttcgttctgccatccctagcac |
46107878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 253 - 304
Target Start/End: Complemental strand, 41668055 - 41668004
Alignment:
| Q |
253 |
ggacatgtatttttatactagccagccattgatttttgtttcttttattcac |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668055 |
ggacatgtatttttatactagccagccattgatttttgtttcttttattcac |
41668004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 108 - 199
Target Start/End: Complemental strand, 22539469 - 22539378
Alignment:
| Q |
108 |
aaaggcacagccgccagaagtaaggacaatgacagtctcattcccgaacactctcccaaaagccctgcatcacgtggaatccttttgttgtt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| | || |||| | |||| || ||||||||||||| || | ||||||| |
|
|
| T |
22539469 |
aaaggcacagccgccacaagtaaggacaatgacagtcccattcttgtactctcttcataaaggcccgcatcacgtggaaaccatctgttgtt |
22539378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University