View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_99 (Length: 291)
Name: NF0622_low_99
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 15188102 - 15188389
Alignment:
Q |
1 |
agctgttcttgaattctgtctctgattgctgttccctggtttatcagtaaaccaacaaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15188102 |
agctgttcttgaattctgtctctgattgctgttccctggtatatcagtaaaccaaccaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
15188201 |
T |
 |
Q |
101 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttaattttagggaggaa--agagatccaaccattttgtggcatccttcttc |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
15188202 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttagttttagggaggaaagagagatccaaccattttgtggcatccttcttc |
15188301 |
T |
 |
Q |
199 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcttctctctgctcct |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
T |
15188302 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccggcaattcttctcactgttcct |
15188389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 177 - 286
Target Start/End: Complemental strand, 24190455 - 24190346
Alignment:
Q |
177 |
ccattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcttct |
276 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
T |
24190455 |
ccattttgtggtatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcagtacggttcatccccgcaattcttct |
24190356 |
T |
 |
Q |
277 |
ctctgctcct |
286 |
Q |
|
|
| ||| |||| |
|
|
T |
24190355 |
cactgttcct |
24190346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 24190489 - 24190454
Alignment:
Q |
1 |
agctgttcttgaattctgtctctgattgctgttccc |
36 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| |
|
|
T |
24190489 |
agctgttcttgaattctgtctctgattgccgttccc |
24190454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 246
Target Start/End: Original strand, 36913508 - 36913578
Alignment:
Q |
176 |
accattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaaccca |
246 |
Q |
|
|
||||| || ||||| |||||||||||||| || |||||||||||||| | ||||| |||||||| ||||| |
|
|
T |
36913508 |
accatcttatggcaaccttcttcaaacatttctagaaatccagcaaccatacgatcagcattttccaccca |
36913578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University