View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0623_low_2 (Length: 434)
Name: NF0623_low_2
Description: NF0623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0623_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 150 - 347
Target Start/End: Complemental strand, 46255187 - 46254990
Alignment:
| Q |
150 |
aactctatcatatttgttcttcaggtaaggaaaatgcctcagatgtaagattaaaggtgttgaaagaattgtcgcgtctgcaacagagagatcaatcaag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46255187 |
aactctatcatatttgttcttcaggtaaggaagatgcttcatatgtaagattaaaggtgttgaaagaattgccgcgtctgcaacagagagatcaatcaag |
46255088 |
T |
 |
| Q |
250 |
aggggttagatttggtgatggtagtggtcgtggtggcggtagtaggttttcaggtggcggcaggaatggtagatttttaagtgataggttttccaacg |
347 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46255087 |
aggggttagatttggtgatggtagtggccgtggtggcggtagtaggttttcaggttgtggcaggaatggtagattttcaagtgataggttttccaacg |
46254990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 157 - 349
Target Start/End: Complemental strand, 46245492 - 46245300
Alignment:
| Q |
157 |
tcatatttgttcttcaggtaaggaaaatgcctcagatgtaagattaaaggtgttgaaagaattgtcgcgtctgcaacagagagatcaatcaagaggggtt |
256 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||| | | |
|
|
| T |
46245492 |
tcatatttgttctttaggtaaggaaaatgtctcagatgtaagattagaggtgttgaaagaattgccacgtctgcaacagagagatcaatcaagaggtggt |
46245393 |
T |
 |
| Q |
257 |
agatttggtgatggtagtggtcgtggtggcggtagtaggttttcaggtggcggcaggaatggtagatttttaagtgataggttttccaacggt |
349 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
46245392 |
agatttggtgatggtggtggtcgtggtgggggtagtaggttttcaggtggtggcaggaatggtagattttcaagtgatagattttccaacggt |
46245300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 342 - 434
Target Start/End: Original strand, 46256460 - 46256552
Alignment:
| Q |
342 |
ccaacggtccatagtatcgcatgcataagcatcaaaaagtacctgaataattaactgaacatcattaatatccagaccctgcgctgccacaac |
434 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
46256460 |
ccaacgatccatagtatcgcatgcataagcatcaaaaagtacctgaataattaactgaacatcattaatatacagatcctgcgctgccacaac |
46256552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 344 - 432
Target Start/End: Original strand, 46246774 - 46246861
Alignment:
| Q |
344 |
aacggtccatagtatcgcatgcataagcatcaaaaagtacctgaataattaactgaacatcattaatatccagaccctgcgctgccaca |
432 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||| |||||||||||||||||||||| || ||||||||||||||| | ||||||||| |
|
|
| T |
46246774 |
aacgatccatagtatcgtatgcatatgcatcaaaa-gtacctgaataattaactgaacgtcgttaatatccagaccccgtgctgccaca |
46246861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 94; Significance: 1e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 173 - 346
Target Start/End: Complemental strand, 12370350 - 12370177
Alignment:
| Q |
173 |
ggtaaggaaaatgcctcagatgtaagattaaaggtgttgaaagaattgtcgcgtctgcaacagagagatcaatcaagaggggttagatttggtgatggta |
272 |
Q |
| |
|
||||||||||||||||| |||||||||||| || |||| ||||||||||||||| |||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
12370350 |
ggtaaggaaaatgcctctgatgtaagattagagatgttaaaagaattgtcgcgtttgcaaccgagagatcaattgagagggggtagatttggtgatggta |
12370251 |
T |
 |
| Q |
273 |
gtggtcgtggtggcggtagtaggttttcaggtggcggcaggaatggtagatttttaagtgataggttttccaac |
346 |
Q |
| |
|
| ||||| ||||| | |||||||||||| | | | ||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
12370250 |
gcggtcgcggtggggttagtaggttttcggtttgtggcagaagtggtagattttcaagtgataggttttccaac |
12370177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University