View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0623_low_9 (Length: 215)
Name: NF0623_low_9
Description: NF0623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0623_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 3 - 203
Target Start/End: Complemental strand, 17280074 - 17279881
Alignment:
Q |
3 |
gtactacttataatataaaataggaaaatgctaacgagtgtctctgagacactttaaaaaccttaaaaattaggtttttatgcgaagttccgatattttg |
102 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||||| | ||| ||||| | |||||| ||||||||||||||||||||||| ||||||| |
|
|
T |
17280074 |
gtactacctataatataaaatagaaaaatgctaacgagggcctccagaacact-------ctttaaaagttaggtttttatgcgaagttccgttattttg |
17279982 |
T |
 |
Q |
103 |
ggggcatgagggactacctgatttagatcataataatgatcagtttcacttgcttgtgaaagtcttttgttgtgtaaaggttgaagttcttgattgatat |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17279981 |
ggggcatgagggactacctgatttagatcataataatgatcagtttcacttgcttgtgaaagtcttttgttgtgtaaaggttgaagttcttgattgatat |
17279882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University