View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0624_high_7 (Length: 287)
Name: NF0624_high_7
Description: NF0624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0624_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 264
Target Start/End: Original strand, 1020118 - 1020352
Alignment:
| Q |
30 |
ggttcaactacaatctcaaaccacaaaagattcaagaaagtagcaacagtggtgagagttgcagtgtttgcatatttttatgtttctttaagaacaagaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020118 |
ggttcaactacaatctcaaaccacaaaagattcaagaaagtagcaacagtggtgagagttgcagtgtttgcatatttttatgtttctttaagaacaagaa |
1020217 |
T |
|
| Q |
130 |
aacctccttgtatgctccaagttcacatcgagatttgtatgatccatacaatgtagttaaaattgttgtttcaagctacaacattggaagcttatcagaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020218 |
aacctccttgtatgctccaagttcacctcgagatttgtatgatccatacaatgtagttaaaattgttgtttcaagctacaacattggaagcttatcagaa |
1020317 |
T |
|
| Q |
230 |
aagaccgagactagttctctaagtttaagtgatga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020318 |
aagaccgagactagttctctaagtttaagtgatga |
1020352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 102 - 141
Target Start/End: Complemental strand, 658825 - 658786
Alignment:
| Q |
102 |
tatttttatgtttctttaagaacaagaaaacctccttgta |
141 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
658825 |
tatttttatgtttctttaataacaagaaaacctccttgta |
658786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 101
Target Start/End: Complemental strand, 36662368 - 36662311
Alignment:
| Q |
44 |
ctcaaaccacaaaagattcaagaaagtagcaacagtggtgagagttgcagtgtttgca |
101 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
36662368 |
ctcaaatcacaaaagtttcaagacagtagcaacagtggctggagttgcagtgtttgca |
36662311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 249
Target Start/End: Complemental strand, 36662198 - 36662126
Alignment:
| Q |
177 |
acaatgtagttaaaattgttgtttcaagctacaacattggaagcttatcagaaaagaccgagactagttctct |
249 |
Q |
| |
|
|||||||| ||||||||| |||||||||| | |||| | |||||||||||| ||| || | ||| |||||||| |
|
|
| T |
36662198 |
acaatgtatttaaaattgctgtttcaagcaataacactagaagcttatcaggaaaaactgggacaagttctct |
36662126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2667 times since January 2019
Visitors: 4010