View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0624_low_10 (Length: 297)
Name: NF0624_low_10
Description: NF0624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0624_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 63 - 297
Target Start/End: Complemental strand, 34671031 - 34670797
Alignment:
| Q |
63 |
catgtagcaccatggtttttgttatgtgccacattgctgtcttttggaaccacttcatttgcttggtcaataagctaaacaaacagaaaaaatccaaaat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34671031 |
catgtagcaccatggtttttgttatgtgccacattgctgtcttttggaaccacttcatttgcttgctcaataagctaaacaaacagaaaaaatccaaaat |
34670932 |
T |
 |
| Q |
163 |
tatttctggtagtgactaatgaagattaagcatatgaatttagttaaaaataaattacaaaattagtttacctttgtctcattaggctcttgtagtatgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34670931 |
tatttctggtagtgactaatgaagattaagcatatgaatttagttaaaaataaaatacaaaattagtttacctttgtctcattaggctcttgtagtatgt |
34670832 |
T |
 |
| Q |
263 |
ctgcatatttgatgacaccgcgtaagaaaagcatg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34670831 |
ctgcatatttgatgacaccgcgtaagaaaagcatg |
34670797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University