View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0624_low_9 (Length: 340)
Name: NF0624_low_9
Description: NF0624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0624_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 311
Target Start/End: Complemental strand, 18513984 - 18513691
Alignment:
Q |
18 |
gcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatca |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18513984 |
gcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatca |
18513885 |
T |
 |
Q |
118 |
tgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctg |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18513884 |
tgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctg |
18513785 |
T |
 |
Q |
218 |
tagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcaattgtgaccgcat |
311 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
18513784 |
tagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcagttgtgaccgcat |
18513691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University