View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0625_low_4 (Length: 287)
Name: NF0625_low_4
Description: NF0625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0625_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 55 - 243
Target Start/End: Complemental strand, 34956415 - 34956227
Alignment:
| Q |
55 |
ggacatcatcagcatgagtcttattatggagatcgtgatacagatagccttgttaaggtacacattatatttaatttaaattagcatgatttgtatcatt |
154 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956415 |
ggacatcatgagcatgagtcttattatggagatcgtgatacagatagccttgttaaggtacacattatatttaatttaaattagcatgatttgtatcatt |
34956316 |
T |
|
| Q |
155 |
ttactttgaagtgtttatgcttttaagtataactgaacatcactgtttaccattagagtataacatgcctgatatgaagtgtctctgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34956315 |
ttactttgaagtgtttatgcttttaagtataattgaacatcactgtttaccattagagtacaacatgcctgatatgaagtgtctctgct |
34956227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 53 - 131
Target Start/End: Original strand, 31391018 - 31391094
Alignment:
| Q |
53 |
atggacatcatcagcatgagtcttattatggagatcgtgatacagatagccttgttaaggtacacattatatttaattt |
131 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| ||||||||||| ||||| || ||||| |||| ||||||||||| |
|
|
| T |
31391018 |
atggacatcatgaacatgagtcctattatggagaccgtgatacagaaagcctagtcaaggttcaca--atatttaattt |
31391094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2694 times since January 2019
Visitors: 4010