View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0625_low_9 (Length: 250)

Name: NF0625_low_9
Description: NF0625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0625_low_9
NF0625_low_9
[»] chr8 (1 HSPs)
chr8 (118-245)||(35656046-35656173)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 118 - 245
Target Start/End: Complemental strand, 35656173 - 35656046
Alignment:
118 ctcttaaactaacggacccttaatagttgagaaaaaactcaatagtcgaataactaactagttaaaacaaaggaaagctcacctgtacgcgaggattctg 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
35656173 ctcttaaactaacggacccttaatagttgagaaaaaactcaatagtcgaacaactaactagttaaaccaaaggaaagctcacctgtacgcgaggattctg 35656074  T
218 aaaatcatccatggcaacagctagggct 245  Q
    |||||||||||||||| |||||||||||    
35656073 aaaatcatccatggcagcagctagggct 35656046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University