View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0625_low_9 (Length: 250)
Name: NF0625_low_9
Description: NF0625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0625_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 118 - 245
Target Start/End: Complemental strand, 35656173 - 35656046
Alignment:
Q |
118 |
ctcttaaactaacggacccttaatagttgagaaaaaactcaatagtcgaataactaactagttaaaacaaaggaaagctcacctgtacgcgaggattctg |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
35656173 |
ctcttaaactaacggacccttaatagttgagaaaaaactcaatagtcgaacaactaactagttaaaccaaaggaaagctcacctgtacgcgaggattctg |
35656074 |
T |
 |
Q |
218 |
aaaatcatccatggcaacagctagggct |
245 |
Q |
|
|
|||||||||||||||| ||||||||||| |
|
|
T |
35656073 |
aaaatcatccatggcagcagctagggct |
35656046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University