View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0626_high_16 (Length: 285)

Name: NF0626_high_16
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0626_high_16
NF0626_high_16
[»] chr3 (1 HSPs)
chr3 (30-239)||(31494859-31495068)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 239
Target Start/End: Complemental strand, 31495068 - 31494859
Alignment:
30 acaatgtgattccaattaggaggagattggtggaaaagacagaagtgatgattttatttaagaattcaaagttggagattttgaaattgaaaaataaagc 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
31495068 acaatgtgattccaattaggaggagattggtggaaaagacagaagtgatgattttatttaagaattcaaagttggagattttggaattgaaaaataaagc 31494969  T
130 tgaaaatcatagattggaaagaagtaggcttgagagtatttttatgagtttccaaatgagggctgaaagagaaggaatgaatatggttaggttgcttggt 229  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31494968 tgaaaatcatagattggaaagaagtaggcttgagagtattgttatgagtttccaaatgagggctgaaagagaaggaatgaatatggttaggttgcttggt 31494869  T
230 gaagttgatc 239  Q
    ||||||||||    
31494868 gaagttgatc 31494859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University