View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_high_17 (Length: 284)
Name: NF0626_high_17
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0626_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 39212224 - 39211954
Alignment:
| Q |
1 |
tctcataacaacctcaccggttcacttccggttcagttaactctcctcgaccgtcttattattctccgcctcgactcaaactcattcaccggttctcttc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39212224 |
tctcataacaacctcactggttcacttccggttcagttaactctcctcgaccgtcttattattctccgcctcgactctaactcattcaccggttctcttc |
39212125 |
T |
 |
| Q |
101 |
cttcttttaaccaaactgatttaaaagtttttaacatctccgctaataacctcaccggtccggttcctgttacgaaaactctttcacggtttaaaccggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39212124 |
cttcttttaaccaaactgatttaaaagtttttaacatctccgctaataacctcaccggtccggttcctgttacgaaaactctttcacggtttaaaccggc |
39212025 |
T |
 |
| Q |
201 |
tttgttttcagataacccgggtttatgtggtgagattattcataaacaatgcggtcatcgttctagattct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39212024 |
tttgttttcagataacccgggtttatgtggtgagattattcataaacaatgcggtcatcgttctagattct |
39211954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University