View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_high_9 (Length: 399)
Name: NF0626_high_9
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0626_high_9 |
 |  |
|
[»] chr2 (221 HSPs) |
 |  |
|
[»] chr1 (260 HSPs) |
 |  |
|
[»] chr4 (267 HSPs) |
 |  |
|
[»] scaffold0370 (1 HSPs) |
 |  |
|
[»] chr6 (181 HSPs) |
 |  |
|
[»] chr5 (213 HSPs) |
 |  |
|
[»] chr7 (232 HSPs) |
 |  |
|
[»] scaffold0373 (1 HSPs) |
 |  |
|
[»] scaffold0811 (2 HSPs) |
 |  |
|
[»] scaffold0021 (2 HSPs) |
 |  |
|
[»] scaffold0051 (2 HSPs) |
 |  |
|
[»] scaffold0210 (2 HSPs) |
 |  |
|
[»] scaffold0535 (2 HSPs) |
 |  |  |
|
[»] scaffold0003 (2 HSPs) |
 |  |
|
[»] scaffold0712 (1 HSPs) |
 |  |  |
|
[»] scaffold0709 (1 HSPs) |
 |  |  |
|
[»] scaffold0347 (2 HSPs) |
 |  |
|
[»] scaffold0016 (2 HSPs) |
 |  |
|
[»] scaffold0179 (1 HSPs) |
 |  |
|
[»] scaffold0123 (2 HSPs) |
 |  |
|
[»] scaffold1001 (1 HSPs) |
 |  |
|
[»] scaffold0159 (2 HSPs) |
 |  |  |
|
[»] scaffold0002 (2 HSPs) |
 |  |
|
[»] scaffold0065 (2 HSPs) |
 |  |
|
[»] scaffold0166 (2 HSPs) |
 |  |  |
|
[»] scaffold0060 (3 HSPs) |
 |  |
|
[»] scaffold0056 (5 HSPs) |
 |  |  |
|
[»] scaffold0026 (3 HSPs) |
 |  |  |
|
[»] scaffold0024 (2 HSPs) |
 |  |  |
|
[»] scaffold0337 (1 HSPs) |
 |  |  |
|
[»] scaffold0326 (6 HSPs) |
 |  |  |
|
[»] scaffold0105 (2 HSPs) |
 |  |  |
|
[»] scaffold0339 (1 HSPs) |
 |  |  |
|
[»] scaffold0160 (2 HSPs) |
 |  |  |
|
[»] scaffold0005 (5 HSPs) |
 |  |  |
|
[»] scaffold0001 (2 HSPs) |
 |  |  |
|
[»] scaffold0684 (3 HSPs) |
 |  |  |
|
[»] scaffold0176 (3 HSPs) |
 |  |  |
|
[»] scaffold0119 (2 HSPs) |
 |  |  |
|
[»] scaffold0011 (3 HSPs) |
 |  |  |
|
[»] scaffold0078 (2 HSPs) |
 |  |  |
|
[»] scaffold0007 (3 HSPs) |
 |  |  |
|
[»] scaffold0085 (1 HSPs) |
 |  |  |
|
[»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 221)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 38980253 - 38980074
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
38980154 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38980153 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
38980074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38731829 - 38732006
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
38731928 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38731929 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
38732006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 37272102 - 37271923
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
37272003 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37272002 |
tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
37271923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 26814229 - 26814049
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaattttttgttt |
26814130 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26814129 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
26814049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19183782 - 19183962
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaattttttgttt |
19183881 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19183882 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
19183962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 23989838 - 23990015
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| | |
|
|
T |
23989838 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcactataaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
23989937 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23989938 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
23990015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33732862 - 33733038
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||| | |
|
|
T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttgatccctgcaaaattttttgtttttg |
33732960 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33732961 |
aaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
33733038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 43789192 - 43789012
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
43789192 |
ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
43789093 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
43789092 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtagtttttgg |
43789012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 223 - 399
Target Start/End: Complemental strand, 3838263 - 3838084
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt |
3838164 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3838163 |
tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
3838084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 7814737 - 7814561
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |||||| | |
|
|
T |
7814737 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtcaaaaaaaattgtttttggtccccgcaaaattttttgtttttg |
7814638 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7814637 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttg |
7814561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 17541776 - 17541598
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
17541776 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
17541677 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17541676 |
ttaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
17541598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 40301975 - 40302155
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttgttt |
40302074 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
40302075 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtagtttttgg |
40302155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 44985623 - 44985800
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| | |
|
|
T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaatttgtttttggtccatgcaaaaatttttgtttttg |
44985722 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
44985723 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtagtttttgg |
44985800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 20658061 - 20658238
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| || |||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||| | |
|
|
T |
20658061 |
ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaattgtttttagtccctgcaaaattttttgtttttg |
20658160 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20658161 |
aaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
20658238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 24483401 - 24483577
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||||| | |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttaa |
24483500 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
T |
24483501 |
aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtagtttttgg |
24483577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 43710384 - 43710558
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
||||||||| ||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccctataaaaaaaaaatgtttttggtccctgcaaaattttttgtttttgaaa |
43710483 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
43710484 |
atagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttgg |
43710558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 44073807 - 44073627
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
44073708 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||||||| |
|
|
T |
44073707 |
ttgaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttgg |
44073627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26707873 - 26708050
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||| ||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
26707873 |
ggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaatttgttgtttttg |
26707972 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
26707973 |
aaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttgg |
26708050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 388
Target Start/End: Complemental strand, 5790900 - 5790730
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
5790900 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaattgtttttggtccctgcaaaaaaattttgtt |
5790801 |
T |
 |
Q |
319 |
nn-gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5790800 |
tttgaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5790730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 240 - 399
Target Start/End: Complemental strand, 22881950 - 22881791
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgacccc |
339 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||| |
|
|
T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctaacccc |
22881851 |
T |
 |
Q |
340 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
22881850 |
acttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtagtttttgg |
22881791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 11713845 - 11713665
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
11713845 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttgttt |
11713746 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
11713745 |
ttgaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaattttgtagtttttgg |
11713665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 24483632 - 24483710
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24483632 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
24483710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 43597499 - 43597322
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
43597499 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
43597400 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
43597399 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg |
43597322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8046329 - 8046508
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgttttt--ggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| || ||||| | |||||||| || |
|
|
T |
8046329 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttttttttttgatccctgcagaattttttgtttt |
8046428 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
8046429 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
8046508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 26238816 - 26238991
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |||| ||||||||||||||| |||| |
|
|
T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaattgtgtttggtccctgcaaatttttttgtttttgaaa |
26238915 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa-ttttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
T |
26238916 |
atagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttttgtagtttttgg |
26238991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 41694004 - 41693823
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||| |
|
|
T |
41694004 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaagaaaaaaattgtttttggtccatgtaaaattttttgtt |
41693905 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||| |
|
|
T |
41693904 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaattttttagtttttgg |
41693823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16899996 - 16900074
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
16899996 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttgg |
16900074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16993387 - 16993465
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
16993387 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttgg |
16993465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 41791020 - 41791197
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||| |||||||| | |
|
|
T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg |
41791119 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
41791120 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaattaattttgtagtttttgg |
41791197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 7814505 - 7814428
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttg |
7814428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 225 - 397
Target Start/End: Original strand, 17912452 - 17912627
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||| |||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||| || |
|
|
T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga |
17912551 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgat-gatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||||||| | |||||||||||||||||||||||||||||||| |
|
|
T |
17912552 |
aaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaattttgtagttttt |
17912627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10664984 - 10665162
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| | |||||||||| ||||||||||||| ||||||| |
|
|
T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt |
10665083 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
10665084 |
gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtagtttttgg |
10665162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14393029 - 14392951
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtagtttttgg |
14392951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 31225715 - 31225894
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||||||| |
|
|
T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaaaaaaaatattttgtttttgatccctgcaaatttttttgttt |
31225814 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
31225815 |
ttgaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaattttgtagtttttgg |
31225894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 40786561 - 40786639
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
40786561 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
40786639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 224 - 399
Target Start/End: Complemental strand, 1497943 - 1497765
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||| |||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttgttttt |
1497844 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
T |
1497843 |
gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttttagtttttgg |
1497765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 221 - 388
Target Start/End: Original strand, 12835324 - 12835494
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
12835324 |
tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattttgtt |
12835423 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
12835424 |
tttgaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaatttt |
12835494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 25954423 - 25954247
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| |||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||| | |
|
|
T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaataaaaattttgtttttggtccctgcaaaa-tttttgtttttg |
25954325 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
25954324 |
aaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtagtttttgg |
25954247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 10375070 - 10374898
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||| |
|
|
T |
10375070 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg--taaaaaaaatgtttttggtccctgcaaaatttgttgttttt |
10374973 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggc-acattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10374972 |
gaaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaattttgtagtttttgg |
10374898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29865511 - 29865333
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
29865511 |
ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaatttgtttttggtccctgcaaaattttttgttttt |
29865412 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| || ||| ||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||| |
|
|
T |
29865411 |
gaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaattttatagtttttgg |
29865333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 43592046 - 43592224
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
43592046 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaataatttgtttttggtccttgcaaaattttgttttt |
43592145 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||| |
|
|
T |
43592146 |
--gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtagtttttgg |
43592224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 45442415 - 45442492
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||| ||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
45442415 |
aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
45442492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 31326252 - 31326073
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaattttttgttt |
31326153 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||| || |||||||||||||||| |
|
|
T |
31326152 |
tttaaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtagtttttgg |
31326073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 32691413 - 32691491
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
T |
32691413 |
gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttgg |
32691491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 16900206 - 16900149
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 16993597 - 16993540
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19184151 - 19184094
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 37271739 - 37271796
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24483891 - 24483836
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 5790557 - 5790615
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5790557 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 19831694 - 19831616
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
19831694 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttgg |
19831616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 26813865 - 26813923
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
26813865 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 7814246 - 7814303
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
7814246 |
ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 17541382 - 17541439
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
17541382 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36622250 - 36622425
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaatgtttttggtccctgcaaatttttttatttttt |
36622348 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| |||||||||||||||||||| || ||||| || || ||||| ||||| |||||||||| |
|
|
T |
36622349 |
aaaatagtccatgaccccatttttgtgatgatttgcatac-tgccacatgatgacggaaccgattttatagtttttgg |
36622425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 43788858 - 43788915
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
43788858 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
43788915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 3671193 - 3671137
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3671193 |
tggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5334750 - 5334806
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
5334750 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 5335041 - 5334985
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
5335041 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 8046649 - 8046593
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
8046649 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 11713484 - 11713540
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11713484 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20131682 - 20131626
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
20131682 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 22881613 - 22881665
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2481557 - 2481502
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
2481557 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3837933 - 3837988
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4423895 - 4423950
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
4423895 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9195206 - 9195151
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
9195206 |
ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11788416 - 11788361
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11788416 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14003742 - 14003687
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
14003742 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15842823 - 15842768
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
15842823 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16522991 - 16523046
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
16522991 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16523325 - 16523270
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
16523325 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24358616 - 24358671
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
24358616 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25705449 - 25705394
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
25705449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29859872 - 29859817
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29859872 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 33733242 - 33733187
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
33733242 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40302339 - 40302284
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
40302339 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43597154 - 43597209
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
43597154 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 27311069 - 27311015
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
27311069 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 146328 - 146381
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 38639412 - 38639469
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt |
38639469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1497609 - 1497665
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| |||||||||||||||||||| |||||||||||| |
|
|
T |
1497609 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 9195053 - 9195109
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 10671941 - 10671889
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
10671941 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 34317797 - 34317853
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
34317797 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3671003 - 3671058
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||| |||||||||||| |
|
|
T |
3671003 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4424185 - 4424130
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
4424185 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10665294 - 10665239
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13215060 - 13215115
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13215060 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14003409 - 14003464
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
14003409 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16673771 - 16673716
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
16673771 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18113089 - 18113144
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
T |
18113089 |
ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20131317 - 20131372
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
20131317 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24358945 - 24358890
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
24358945 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25705085 - 25705140
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25705085 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26239160 - 26239105
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 27109072 - 27109127
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| |||||| |||||||||||||||||||||||||||||| |
|
|
T |
27109072 |
tggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27310876 - 27310930
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg |
27310930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30215422 - 30215477
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
30215422 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31226077 - 31226022
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||||||||| |||||| |
|
|
T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg |
31226022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
33576117 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41451837 - 41451892
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
41451837 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41693674 - 41693729
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 42695867 - 42695922
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
42695867 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44559062 - 44559117
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
44559062 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44985984 - 44985929
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
44985984 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 17912808 - 17912754
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggt |
17912754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 146691 - 146635
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
146691 |
tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 4042610 - 4042662
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
4042610 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31325919 - 31325975
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
31325919 |
tggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 36806897 - 36806841
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
36806897 |
tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40124965 - 40125021
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
T |
40124965 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 41791313 - 41791261
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||||||| |||| |
|
|
T |
41791313 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 322 - 398
Target Start/End: Complemental strand, 44993957 - 44993881
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || || |||| |||| |||||||||| |
|
|
T |
44993957 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtagtttttg |
44993881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2265397 - 2265342
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
2265397 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10671630 - 10671685
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16673411 - 16673466
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
16673411 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17302143 - 17302088
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||||||||||| |||||||||||||||||||||| |
|
|
T |
17302143 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 20939216 - 20939157
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
T |
20939216 |
gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
20939157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 23732220 - 23732161
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
23732220 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
23732161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 31644841 - 31644892
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
31644841 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32476095 - 32476150
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
T |
32476095 |
ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32691313 - 32691368
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
T |
32691313 |
ggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg |
32691368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33575752 - 33575807
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
33575752 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37911120 - 37911065
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
T |
37911120 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 38979888 - 38979947
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatat-gcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
38979888 |
tggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40786460 - 40786515
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| || ||||||||||| |||||||||||||||||||||| |
|
|
T |
40786460 |
ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43710708 - 43710653
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| || ||||||||||||||||||||||||||||||||| |
|
|
T |
43710708 |
ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
Q |
228 |
aatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||| ||||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
1138091 |
gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
1138144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 4042891 - 4042838
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
4042891 |
tggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
25750857 |
gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
25750804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 34318084 - 34318031
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||| |||||| |||||||||||||||||| ||||||||| |
|
|
T |
34318084 |
tggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 3172020 - 3172072
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
3172020 |
ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3172532 - 3172480
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
T |
3172532 |
ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 18113455 - 18113399
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||| ||||||||| |||||||||||||| |||||| |
|
|
T |
18113455 |
tggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 25954115 - 25954167
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
25954115 |
ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34964160 - 34964104
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
T |
34964160 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 45442696 - 45442644
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
T |
45442696 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1138359 - 1138304
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
T |
1138359 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2481193 - 2481248
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || | |||||||||| |||||||||||||||||||||| |
|
|
T |
2481193 |
ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4424004 - 4424063
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
4424004 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4424063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4842940 - 4842999
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| |||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
T |
4842940 |
gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacccattt |
4842999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13850522 - 13850577
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| || ||||||||||| |||| ||||||||||||||||| |
|
|
T |
13850522 |
ggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctg |
13850577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16523098 - 16523157
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
16523098 |
gtccctggcgccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16523157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 270
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 270
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23732328 - 23732274
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||| ||||||||||| |
|
|
T |
23732328 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg |
23732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 27109151 - 27109210
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
27109151 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
27109210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30215871 - 30215816
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| | |||||||||||||||||||| |
|
|
T |
30215871 |
ggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 31909370 - 31909311
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
31909370 |
gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
31909311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 31909478 - 31909428
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
T |
31909478 |
ggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36815835 - 36815780
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
T |
36815835 |
ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 37228733 - 37228784
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
37228733 |
ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40125075 - 40125134
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
40125075 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40125134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40125289 - 40125234
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
T |
40125289 |
ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43671934 - 43671989
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| |||||||| |||||||||||||||| |||| |
|
|
T |
43671934 |
ggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 43672041 - 43672100
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||| ||||||| ||||||||||| || |||||||| |||| |
|
|
T |
43672041 |
gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacccattt |
43672100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 44994061 - 44994010
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||| |||||||||||||| |||||||| ||||||||| |
|
|
T |
44994061 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 268
Target Start/End: Original strand, 29831814 - 29831860
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
268 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
T |
29831814 |
ggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||| ||||| | |||||||||||| ||||||||||||||||||||| |
|
|
T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 23732038 - 23732091
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
T |
23732038 |
tggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 381
Target Start/End: Complemental strand, 1295437 - 1295385
Alignment:
Q |
329 |
tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||||||| ||||||||||||||||||||| | ||||||||| || ||||||| |
|
|
T |
1295437 |
tccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaac |
1295385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| || ||||||||||||| ||||||||||||||||| |
|
|
T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 14393128 - 14393077
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| | |||||| |||||||||||| ||||||||||||||||||| |
|
|
T |
14393128 |
ggctaaaatat-gatttagttcctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 278
Target Start/End: Complemental strand, 33576074 - 33576030
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
T |
33576074 |
gttttagtccctgcaaatatgtctcattttggttttggtccctgg |
33576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 45442316 - 45442364
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
T |
45442316 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 2481302 - 2481357
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
2481302 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
2481357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 3832388 - 3832439
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
3832388 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
3832439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 4042781 - 4042722
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| |||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
4042781 |
gtccctgacttcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
4042722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4423968 - 4424011
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
4424011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4794203 - 4794246
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
4794246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10671739 - 10671798
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | |||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
10671739 |
gtccctggctccacttttctgatgatttgcacacgtggcacatgatgactgaacccattt |
10671798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| | ||| ||||||||||||||| |||||||||||||| |
|
|
T |
13215365 |
ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 16523062 - 16523105
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccctgg |
16523105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 20658409 - 20658362
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||| |||| |
|
|
T |
20658409 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 242 - 277
Target Start/End: Complemental strand, 26708184 - 26708149
Alignment:
Q |
242 |
ccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |
|
|
T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctg |
26708149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 26709696 - 26709747
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||| |||||||||||| ||||||||||| |||||| |
|
|
T |
26709696 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 34317915 - 34317966
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
34317915 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
34317966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35155619 - 35155564
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||| || |||||| |||||||||||| |
|
|
T |
35155619 |
ggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Complemental strand, 35686224 - 35686173
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| |||| |||||| || |||||||| |||| |
|
|
T |
35686224 |
ccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
35686173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37910756 - 37910811
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||| |||| ||||||||||||| |
|
|
T |
37910756 |
ggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg |
37910811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 37911011 - 37910952
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| | |||||| || || |||||||| |||| |
|
|
T |
37911011 |
gtccctgactccacttttgtgatgatttgcacatgtggcatatgatgactgaacccattt |
37910952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 41451946 - 41452001
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
41451946 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
41452001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43672318 - 43672263
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| | ||||||||||||||||||| |
|
|
T |
43672318 |
ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 1696230 - 1696284
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||| ||||||||||||||||| | ||||||||||| || |||||||| |
|
|
T |
1696230 |
gtccctgacctcacttttgtgatgatttaaacacgtggcacatgatgactgaacc |
1696284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||| ||||| |||||| |||||||| |||||||||||||||||| |
|
|
T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 333 - 387
Target Start/End: Complemental strand, 13215311 - 13215257
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||| |||||||||||| | ||||||||| || |||||||| |||| |
|
|
T |
13215311 |
tgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacccattt |
13215257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
T |
29182277 |
gtccctgactccacttttgtgatgatttgcacacgtgacacat |
29182319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |
|
|
T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 358
Target Start/End: Original strand, 37228831 - 37228861
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgca |
358 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
37228831 |
gtccctgaccccacttttgtgatgatttgca |
37228861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 38732120 - 38732078
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
T |
38732120 |
ttttagtcccagcaaatatggctcgttttggttttaatccctg |
38732078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 387
Target Start/End: Complemental strand, 44559299 - 44559241
Alignment:
Q |
329 |
tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||| |||||||| |||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
44559299 |
tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacccattt |
44559241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 334 - 387
Target Start/End: Original strand, 13850635 - 13850688
Alignment:
Q |
334 |
gaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||| ||||| ||||| || | |||||| |||| |
|
|
T |
13850635 |
gaccccacttttgtgatgatttgcacacgtgacacatgatgattgaacccattt |
13850688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 263
Target Start/End: Complemental strand, 32691635 - 32691594
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgtttt |
263 |
Q |
|
|
|||||||| || ||||||||||||||||||||| |||||||| |
|
|
T |
32691635 |
ggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||| |||||| |||||||||| ||||||||||||||| |||||| |
|
|
T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg |
44993858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||| |
|
|
T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 1295544 - 1295492
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| | |||||||||||| ||||||||||||||||||||| |
|
|
T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg |
1295492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 387
Target Start/End: Complemental strand, 5164376 - 5164328
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
5164376 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
5164328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 13802486 - 13802534
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| |||||||| | || |||||| |||||||||||||||| |
|
|
T |
13802486 |
ggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||| |||||||||| |||||||||||||||| |||| |
|
|
T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 35155405 - 35155465
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||| ||||||||||| | ||| ||||| || ||||||| ||||||||| |
|
|
T |
35155405 |
ctgaccccacttttgggatgatttgcacatgtgccacatgatgactgaactcattttgtag |
35155465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 38231430 - 38231486
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| ||||||||||||| ||| |||||| |||||||||||| |
|
|
T |
38231430 |
tggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctg |
38231486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 380
Target Start/End: Original strand, 38231544 - 38231592
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||||||||||||| ||||||| | ||||||||| || |||||| |
|
|
T |
38231544 |
ctgaccccacttttgtgataatttgcacatgtggcacatgatgactgaa |
38231592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 43592380 - 43592328
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||| |||||| ||| ||||| ||||||||| |
|
|
T |
43592380 |
ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc |
43592328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 260)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18473272 - 18473451
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
18473371 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18473372 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
18473451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 32729049 - 32728870
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
32728950 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32728949 |
tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
32728870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 7001898 - 7001717
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7001898 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtt |
7001799 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7001798 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg |
7001717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14007489 - 14007666
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaatttttagtttttg |
14007588 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
14007589 |
aaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtagtttttgg |
14007666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 395
Target Start/End: Complemental strand, 41358663 - 41358488
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
41358663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggttt |
41358564 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
395 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41358563 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
41358488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 31258339 - 31258519
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
31258339 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgttt |
31258438 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
31258439 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
31258519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 3679626 - 3679803
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||| ||||||| | |
|
|
T |
3679626 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttctggtccttgcaaaaatttttgtttttg |
3679725 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
3679726 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
3679803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 12361011 - 12361190
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
12361011 |
ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagtttgtttttcgtccctgcaaaattttttgttta |
12361110 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12361111 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
12361190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 48956067 - 48955886
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
48956067 |
tggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtt |
48955968 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48955967 |
tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
48955886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19622655 - 19622835
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
T |
19622655 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
19622754 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
19622755 |
ttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
19622835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26061956 - 26062136
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaattttttgttt |
26062055 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26062056 |
ttgaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtagtttttgg |
26062136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22919684 - 22919861
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| | |
|
|
T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
22919783 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
22919784 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
22919861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 45290457 - 45290636
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtcccagcaaaattttttgtttt |
45290556 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
45290557 |
ttaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
45290636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 35308112 - 35307931
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
35308112 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaattttttgtt |
35308013 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35308012 |
tttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
35307931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 41881093 - 41881273
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
41881093 |
ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaaatttttgttt |
41881192 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
41881193 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttgg |
41881273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 13259988 - 13260165
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||| ||||||||| |||||| |||| | |
|
|
T |
13259988 |
ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaaaaaaaaattgtttttgttccctgtaaaattttttgtttatg |
13260087 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
13260088 |
aaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
13260165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 24649349 - 24649529
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||| |
|
|
T |
24649349 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctgaaaaaaaaaaatttgtttttggcccctgcaaaattttttgttt |
24649448 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24649449 |
tttaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
24649529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 29688428 - 29688254
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
29688428 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
29688331 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
T |
29688330 |
aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccatttttttagtttttg |
29688254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 389
Target Start/End: Original strand, 990088 - 990256
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
990088 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa--tttttgttt |
990185 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
389 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
990186 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
990256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 221 - 389
Target Start/End: Complemental strand, 44641433 - 44641266
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
T |
44641433 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgtaaaattttttgttttt |
44641334 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
389 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44641333 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
44641266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33379888 - 33380066
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
33379987 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || || |||||||||||||||||||||| |
|
|
T |
33379988 |
taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtagtttttgg |
33380066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 21383104 - 21383281
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||| | |
|
|
T |
21383104 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaataaaatgtttttggtccctgcaaaattttttgtttttg |
21383203 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
21383204 |
aaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
21383281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 32454294 - 32454111
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn------ttgtttttggtccctgcaaaannnnnnn |
315 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
32454195 |
T |
 |
Q |
316 |
nnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
32454194 |
tttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
32454111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 21391371 - 21391199
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| ||||||||||||| |||||||||||||||| ||||||||| ||| | |||||||||||| |||||||| |||| |
|
|
T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctg-tgaaaaaaattgtttttggtctctgcaaaaatttttgtttttgaaa |
21391273 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
21391272 |
atagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
21391199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 4323829 - 4324008
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||| ||| |||||||| |||||||||||| |
|
|
T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaattttttgtttt |
4323928 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
4323929 |
tgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttatagtttttgg |
4324008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 26191358 - 26191537
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| ||||||| |
|
|
T |
26191358 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttt |
26191457 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
26191458 |
tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
26191537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 2733285 - 2733363
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
2733363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 13770489 - 13770666
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt |
13770588 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||||| |
|
|
T |
13770589 |
tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtagttttt |
13770666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 390
Target Start/End: Complemental strand, 15335292 - 15335124
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| | |
|
|
T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttttg |
15335193 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
390 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
15335192 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
15335124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 32626792 - 32626714
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtagtttttgg |
32626714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 18302281 - 18302204
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18302281 |
aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
18302204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 18900130 - 18899956
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaaattgtttttggtccctgcaaaattttttgttttt-aa |
18900032 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
18900031 |
aatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
18899956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 10552212 - 10552134
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10552212 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg |
10552134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17984595 - 17984517
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
17984595 |
gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
17984517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 1159739 - 1159662
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
T |
1159739 |
gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtagtttttg |
1159662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 11822004 - 11822181
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| |
|
|
T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt |
11822103 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||| ||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
T |
11822104 |
gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttg |
11822181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 326 - 399
Target Start/End: Original strand, 35005491 - 35005564
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35005491 |
tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
35005564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 52254183 - 52254360
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
T |
52254183 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaatttttttatttttt |
52254282 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| |||| | |||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
52254283 |
aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
52254360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 50429209 - 50429031
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
50429209 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggttcctgcaaaattttttgtttt |
50429110 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
50429109 |
tgaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaaccagctttgtagtttttgg |
50429031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 26442899 - 26442721
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
T |
26442899 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcacaattttttgttt |
26442800 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
26442799 |
ttgaaaatagtccc--acaccacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtagtttttgg |
26442721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 7819103 - 7818923
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
7819103 |
ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
7819004 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
7819003 |
ttgaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtttttgg |
7818923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 34383047 - 34383125
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
34383047 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttgg |
34383125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 3753214 - 3753390
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| | |
|
|
T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaattgtttttggtccctgcaaaattttttgtttttta |
3753312 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttgg |
399 |
Q |
|
|
|||| |||| |||||||| |||||||||||||||||||||||| ||| || |||||| ||| ||||||||||||||| |
|
|
T |
3753313 |
aaatggtccttgaccccatttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttttgtagtttttgg |
3753390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 4360370 - 4360447
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
T |
4360370 |
aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaattttatagtttttgg |
4360447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29072497 - 29072677
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
29072596 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| |||||||||||||| || |||| ||| |||||||| ||||||| |
|
|
T |
29072597 |
tttaaaatagtccctgaccccatttttgtgatgattcgcatacgtggcacaagatgactggacccattttgtaatttttgg |
29072677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 34808200 - 34808373
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| |||||||||||| |||||||| |||||||||||||||||||||| | ||||||||||||||||||| ||| |
|
|
T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg-taaaaaaaaatgtttttggtccctgcaaatttttttgttttttaaa |
34808298 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
34808299 |
atagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtagtttttgg |
34808373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 16083154 - 16083231
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
16083154 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
16083231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 46868329 - 46868406
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
46868329 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg |
46868406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 1811170 - 1811092
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| ||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
1811170 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg |
1811092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 20756120 - 20756198
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| | ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||| |
|
|
T |
20756120 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg |
20756198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 33067629 - 33067559
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
T |
33067629 |
aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag |
33067559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 49226361 - 49226415
Alignment:
Q |
345 |
tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49226361 |
tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
49226415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 990379 - 990322
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 41358369 - 41358426
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 224 - 397
Target Start/End: Complemental strand, 45368847 - 45368674
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||| || |
|
|
T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattatttttggtccctgcaaaaattttcgttttttaa |
45368748 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||| |||| || ||||||| |||||||||||||| |
|
|
T |
45368747 |
aatagtccctgaccccatttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtagttttt |
45368674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 48609493 - 48609416
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||| |
|
|
T |
48609493 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtagtttttgg |
48609416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1810927 - 1810982
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18302387 - 18302332
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45368490 - 45368545
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 18473595 - 18473541
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 323 - 397
Target Start/End: Complemental strand, 22953454 - 22953380
Alignment:
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||| ||| |||||||||||||||| |||||||| || ||||||||| ||||||||||||||||||| |
|
|
T |
22953454 |
aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaattttgtagttttt |
22953380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19623017 - 19622960
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19623017 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 37545850 - 37545773
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||| ||||||||| ||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
37545850 |
aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtagtttttgg |
37545773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 45290820 - 45290763
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
45290820 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24653801 - 24653857
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
24653801 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 29072863 - 29072807
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
29072863 |
tggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 35005744 - 35005692
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35005744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 37545627 - 37545683
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37545627 |
tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 38151213 - 38151157
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38151213 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 52254480 - 52254424
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
52254480 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3753572 - 3753517
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
3753572 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6567496 - 6567441
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13260321 - 13260266
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21391096 - 21391151
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
21391096 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24507843 - 24507788
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
24507843 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26142420 - 26142591
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||||||||| || | |||||||||||||||||||||||||||| ||| |||||||| |||||||||||| |
|
|
T |
26142420 |
ggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgtaaaaaaaaaatttgttttttgtccctgcaaaattttttgtttt |
26142519 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
26142520 |
tgaaaatagtccctgaccccacttttgtgatgatttgc--------cacattataactgaaccaattttgttgtttttgg |
26142591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33045690 - 33045635
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
33045690 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35307715 - 35307770
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 38164295 - 38164240
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38164295 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47819232 - 47819287
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
47819232 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47819596 - 47819541
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
47819596 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 50799130 - 50799185
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 26191735 - 26191682
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
26191735 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 46868578 - 46868521
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
46868578 |
tggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 3679987 - 3679931
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
3679987 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 10631163 - 10631219
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
10631163 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 16060886 - 16060830
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
16060886 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 17984702 - 17984650
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17984702 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24507478 - 24507534
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
24507478 |
tggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24977777 - 24977833
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
24977777 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 27521676 - 27521755
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac--tgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| | || ||||||||||||||||||||||||||||| || || |||||| |||||||||||||||| |
|
|
T |
27521676 |
aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtagtttttgg |
27521755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35056529 - 35056585
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35056529 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 38136982 - 38136926
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38136982 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40718109 - 40718165
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
40718109 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 45380637 - 45380581
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
45380637 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 45638579 - 45638635
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
45638579 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 48730509 - 48730445
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| ||||| || |||||||| ||||||||| |
|
|
T |
48730509 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtag |
48730445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3247198 - 3247253
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3247198 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8140434 - 8140489
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8140434 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8140799 - 8140744
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
8140799 |
ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10631528 - 10631473
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
10631528 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11822365 - 11822310
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12360968 - 12360913
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12360968 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 15516582 - 15516637
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
T |
15516582 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15526362 - 15526307
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
15526362 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16026938 - 16026883
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
16026938 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 17984333 - 17984384
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
17984333 |
ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19720712 - 19720767
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19720712 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 226 - 277
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26324585 - 26324640
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
26324585 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30322929 - 30322984
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
30322929 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30323293 - 30323238
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
30323293 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32626529 - 32626584
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33000669 - 33000614
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
33000669 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33234546 - 33234601
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
33234546 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34002940 - 34002885
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
34002940 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35056894 - 35056839
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
35056894 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39747835 - 39747780
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
39747835 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45380272 - 45380327
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
45380272 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 48609236 - 48609291
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
T |
48609236 |
ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 48609594 - 48609543
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 48955714 - 48955765
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48955714 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 10887598 - 10887544
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10887598 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 16026573 - 16026627
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
16026573 |
ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 271
Target Start/End: Complemental strand, 22953557 - 22953507
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag |
271 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
T |
22953557 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||||||||||||||| |||| |||||||||||||||||||||| |
|
|
T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 44158042 - 44157988
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
T |
44158042 |
ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 39303874 - 39303817
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||| | |||||||||||||||| |
|
|
T |
39303874 |
ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtagtttttgg |
39303817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 12322971 - 12322915
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
12322971 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 18079516 - 18079572
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||| |
|
|
T |
18079516 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag |
18079572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 22919977 - 22919925
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||| |||||||||||||||||||| |||||||||| |
|
|
T |
22919977 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31060786 - 31060842
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
T |
31060786 |
tggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 33234913 - 33234857
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
33234913 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 37624746 - 37624798
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |||| |
|
|
T |
37624746 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 41738795 - 41738851
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
T |
41738795 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7867129 - 7867184
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
T |
7867129 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8364916 - 8364861
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| ||||| ||||||||| |||||||||||||| ||||||| |
|
|
T |
8364916 |
ggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10887233 - 10887288
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10887233 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 18927890 - 18927945
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||| || ||||||||||||| |
|
|
T |
18927890 |
ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt |
18927945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 19198836 - 19198781
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||| |
|
|
T |
19198836 |
ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacccattt |
19198781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21383428 - 21383373
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||| ||| |||||||||||||| ||||| |||||||||||| |
|
|
T |
21383428 |
ggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg |
21383373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 24510051 - 24510110
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
T |
24510051 |
gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt |
24510110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24654167 - 24654112
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
24654167 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24978122 - 24978067
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
T |
24978122 |
ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 26324947 - 26324896
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
26324947 |
ggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33045355 - 33045410
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| | ||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
T |
33045355 |
ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 39025382 - 39025328
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
T |
39025382 |
tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||| ||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 234 - 276
Target Start/End: Original strand, 292871 - 292913
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
292871 |
gttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 264
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttg |
264 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
T |
8364867 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac |
8364814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 41739120 - 41739068
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
41739120 |
ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 15211859 - 15211803
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
T |
15211859 |
tggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20948754 - 20948810
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||| |||||||| ||||||| |||||||||||||| |
|
|
T |
20948754 |
tggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 25658013 - 25658069
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||| ||||||||| ||||||||||||||| |||||| |
|
|
T |
25658013 |
tggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 33067348 - 33067400
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||| |||| |
|
|
T |
33067348 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40718475 - 40718419
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| | |||||| |||||||||||| |
|
|
T |
40718475 |
tggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 45638894 - 45638846
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
T |
45638894 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4360626 - 4360571
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||| |||||||| ||||| |
|
|
T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg |
4360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4789417 - 4789476
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
T |
4789417 |
gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt |
4789476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 7867357 - 7867302
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| || |||||||||||||||||| |
|
|
T |
7867357 |
ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10887342 - 10887401
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
10887342 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
10887401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 12322718 - 12322773
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||| |||||||||||| | ||||||||| |||| ||||||||||| |
|
|
T |
12322718 |
ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaattt |
12322773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12360603 - 12360658
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||| ||||||| ||||| |
|
|
T |
12360603 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 12360712 - 12360771
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| | ||||||||| || | |||||| |||| |
|
|
T |
12360712 |
gtccctgaccccacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt |
12360771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 14007875 - 14007824
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||||||||||| || | |||||||||||||||| ||||||||| |
|
|
T |
14007875 |
ggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtc |
14007824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 15211511 - 15211562
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||| |||||||||||||||||| |
|
|
T |
15211511 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 16060596 - 16060646
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| |||||| ||||||||||||||||||||||||||| |
|
|
T |
16060596 |
ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16060704 - 16060763
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
16060704 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16060763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 16083047 - 16083098
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||| ||||||||| |||||||| ||||||||| |
|
|
T |
16083047 |
ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 17129975 - 17129916
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| |||||||| || || |||||||| |||| |
|
|
T |
17129975 |
gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt |
17129916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18079398 - 18079453
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
T |
18079398 |
ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28507458 - 28507403
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
T |
28507458 |
ggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31061151 - 31061096
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 42482979 - 42483030
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||| |
|
|
T |
42482979 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 50428873 - 50428928
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| ||||||||| ||||| |||||| |
|
|
T |
50428873 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 15058766 - 15058716
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
15058766 |
ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||| |||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 277
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
Q |
239 |
agtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctg |
18302108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||| |||||| |||||||| |
|
|
T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc |
22953308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| ||||||||||||| ||||||| ||| ||||||||||||| |||||| |
|
|
T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 33380258 - 33380204
Alignment:
Q |
221 |
tggctaaaatatagttttagtccc-tgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||| ||| | |||||||||||||||||||||||||||| |
|
|
T |
33380258 |
tggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc |
34382997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 383
Target Start/End: Complemental strand, 42483217 - 42483167
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
|||||||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
T |
42483217 |
tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca |
42483167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||| ||||| |||| ||||||||||||||||||| |||||||||| |
|
|
T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 49073691 - 49073745
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| ||||||||||||||| ||||| |
|
|
T |
49073691 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
49073944 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacat |
49073902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| ||||| ||| |||||||||| |||||||||||||||||||| |
|
|
T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 24977898 - 24977947
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
24977898 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24977947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 25658299 - 25658246
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||| |||||||||||||||||||||||| |||||||||||| |
|
|
T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 330 - 367
Target Start/End: Original strand, 32420208 - 32420245
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggca |
367 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| |
|
|
T |
32420208 |
ccctgaccccacttttgtgatgatttgcacacgtggca |
32420245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 1159840 - 1159784
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||| | ||||||| ||||| ||||||||||||||||||| |
|
|
T |
1159840 |
tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg |
1159784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 19720965 - 19720913
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||| ||||||||||||| ||||||| ||||||||||| || |||||| |
|
|
T |
19720965 |
gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaa |
19720913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 387
Target Start/End: Original strand, 34002691 - 34002743
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||| |||||||| ||||||||||| || ||||| ||||||| |
|
|
T |
34002691 |
accccacttttgtgacgatttgcacacgtggcacatgatgactgagccaattt |
34002743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 46184051 - 46183999
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||| ||||||| ||||||| ||| |||||||||| ||||||| |
|
|
T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctg |
46183999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 321 - 364
Target Start/End: Original strand, 292959 - 293002
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg |
364 |
Q |
|
|
||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
292959 |
gaaaatagtccatagccccacttttgtgatgatttgcatacgtg |
293002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4565336 - 4565281
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||| | ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
4565336 |
ggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 7350663 - 7350620
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctgg |
7350620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 10631419 - 10631364
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
T |
10631419 |
gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca |
10631364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 10887306 - 10887349
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
10887349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 15466249 - 15466300
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
T |
15466249 |
ccccacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt |
15466300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 16026829 - 16026774
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
16026829 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
16026774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 22674203 - 22674254
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||| |||| |||||||||| |||||||||||||||||| |
|
|
T |
22674203 |
ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 24510309 - 24510258
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||| |||||||| |
|
|
T |
24510309 |
tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 379
Target Start/End: Complemental strand, 26324838 - 26324787
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga |
379 |
Q |
|
|
||||||||||||||||||||||||||||||| || || ||||| || ||||| |
|
|
T |
26324838 |
gtccctgaccccacttttgtgatgatttgcacacatgtcacataatgactga |
26324787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 33000560 - 33000505
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
33000560 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
33000505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 38150957 - 38151012
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
38150957 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
38151012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 39747474 - 39747528
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| |||||||| | |||||||||||||||||||||| |
|
|
T |
39747474 |
ggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 41738913 - 41738964
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
41738913 |
ccccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt |
41738964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 42483271 - 42483224
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| | ||||||||||| |
|
|
T |
42483271 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 46183757 - 46183800
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
46183800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 46868226 - 46868277
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||| ||| ||||||||||||||||||||| || |||||||||||||| |
|
|
T |
46868226 |
ggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtc |
46868277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 49923818 - 49923763
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||| |||||||||||| |||||||| |||||||||||| |
|
|
T |
49923818 |
ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 5058838 - 5058888
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||||||| |||||||||||| | ||||||||| || |||||||| |
|
|
T |
5058838 |
ctgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacc |
5058888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| || ||||||||||||||| ||||| |||||||||||| |
|
|
T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |
|
|
T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 36912853 - 36912895
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttg |
264 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
T |
36912853 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 37625026 - 37624976
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| ||||||||||||| ||||||| ||||||||||| ||||| |
|
|
T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12322603 - 12322656
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| |||||||| ||||||||| |
|
|
T |
12322603 |
tggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttg |
264 |
Q |
|
|
|||||||||| |||||| |||||||||||||||||| ||||| |
|
|
T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||| |||||||||||||| |||| |||||||||||| |
|
|
T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg |
29579375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 33045475 - 33045524
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
T |
33045475 |
ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
33045524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 37624802 - 37624859
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||| ||||||||||||||||||| ||||||||||| || | |||| | ||||||||| |
|
|
T |
37624802 |
accctacttttgtgatgatttgcacacgtggcacatcatgaatgaatccattttgtag |
37624859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 37646760 - 37646797
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||| |
|
|
T |
37646760 |
gtccctgcaaatatgcttcgttttgattttagtccctg |
37646797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| ||||| ||||||||||||||| ||||||||| |||| |||| |
|
|
T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 39747592 - 39747641
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
T |
39747592 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
39747641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 44157923 - 44157874
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
T |
44157923 |
ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt |
44157874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
46183812 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
46183857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 47038866 - 47038923
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||| || |||| |||||| ||||||||| |
|
|
T |
47038866 |
ggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggt |
47038923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 15334917 - 15334965
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| |||||| || ||| ||||||| ||||||||||||||| |
|
|
T |
15334917 |
ggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15466131 - 15466187
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||| | | ||||||||| |||||||||||||||||| |
|
|
T |
15466131 |
tggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctg |
15466187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||||| ||||| ||| ||||||||||| ||| |||| ||||||||||| |
|
|
T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34383245 - 34383189
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||| |||| ||||||| | ||||||||||||||||||| |
|
|
T |
34383245 |
tggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctg |
34383189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
T |
51986459 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa |
51986415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 2e-50; HSPs: 267)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 50714566 - 50714386
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
50714566 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
50714467 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50714466 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
50714386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 6827874 - 6827694
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
6827874 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
6827775 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6827774 |
ttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
6827694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 35415299 - 35415478
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35415299 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
35415398 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35415399 |
ttgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
35415478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51709027 - 51708848
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
51708928 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
51708927 |
tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
51708848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 55482469 - 55482291
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||| |||| |
|
|
T |
55482469 |
tggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggttcctgtaaaattttttgttttt |
55482370 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
55482369 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttgg |
55482291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 16712691 - 16712514
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| | |
|
|
T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg |
16712592 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
16712591 |
taaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttgg |
16712514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 41620256 - 41620077
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
41620256 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
41620157 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
41620156 |
ttgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttggagtttttg |
41620077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 13479273 - 13479449
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||| |||| || |
|
|
T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctataaaaaaaaattgtttttggtccctgtaaaattttttgtttttga |
13479372 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
13479373 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
13479449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36702000 - 36702179
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg--tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| | |||||||| |||||||||||| |
|
|
T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgtttttgtttttagtccctgcaaaattttttgtttt |
36702099 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
36702100 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtagtttttgg |
36702179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 38054549 - 38054724
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
38054648 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
38054649 |
aatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtagtttttgg |
38054724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32208542 - 32208720
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaattgtttttggtccctacaaaattttttgttttt |
32208641 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
32208642 |
gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaattttgtagtttttgg |
32208720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 52017870 - 52017690
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaattttttgttt |
52017771 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52017770 |
ttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
52017690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 13064159 - 13064335
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||| | |
|
|
T |
13064159 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgtttttggtccccgcaaaattttttgtttttg |
13064258 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
T |
13064259 |
taaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgtaatttttg |
13064335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 41346218 - 41346039
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |||| | |||||||||||||||||| |
|
|
T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaatcatttttggtccctgcaaaattttttgtttt |
41346119 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41346118 |
tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
41346039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 29463913 - 29463736
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
29463814 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
29463813 |
tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagttttt |
29463736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 22584607 - 22584432
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||| | ||||||||| |||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| | |
|
|
T |
22584607 |
ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
22584509 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
T |
22584508 |
aaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaattttgtagtttttg |
22584432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 41921084 - 41920905
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||| ||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
41921084 |
ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
41920985 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
41920984 |
tgaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
41920905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 4279336 - 4279155
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
4279336 |
tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaataaggaaattttgtttttggtcccagcaaaatattttgtt |
4279237 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4279236 |
tttgaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
4279155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 34355065 - 34355143
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34355065 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
34355143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 34362044 - 34361966
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34362044 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
34361966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 227 - 399
Target Start/End: Complemental strand, 27008401 - 27008228
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaaaa |
325 |
Q |
|
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| |
|
|
T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttgaaaa |
27008302 |
T |
 |
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
27008301 |
tagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
27008228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 35763955 - 35763776
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
35763955 |
ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgttt |
35763856 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||| |||||| |||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||| |
|
|
T |
35763855 |
ttgaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaattttctagtttttg |
35763776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 45593228 - 45593404
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaaaaaaaaatagtttttggtccctgcaaaaatttttgtttttt |
45593327 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
45593328 |
aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
45593404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 51545966 - 51545791
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttcgtttttaaa |
51545867 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
51545866 |
aatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
51545791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18205156 - 18205334
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
18205255 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
T |
18205256 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaactaattttgtagtttttgg |
18205334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 27427944 - 27428022
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtagtttttgg |
27428022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 55072389 - 55072569
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaaatttttgttt |
55072488 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
55072489 |
ttaaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttatagtttttgg |
55072569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 9289266 - 9289442
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt---nnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
9289365 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
T |
9289366 |
ttgaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaattttctagtttttgg |
9289442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 396
Target Start/End: Complemental strand, 24474963 - 24474786
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| || ||||||| |||||||| |||| |
|
|
T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagtaaaaaaaaaaaattgtttt-ggtccctgtaaaattttttgtt |
24474865 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
396 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
24474864 |
tttgaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtagtttt |
24474786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 389
Target Start/End: Complemental strand, 53717175 - 53717004
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
T |
53717175 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaattttttgtt |
53717076 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
389 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
53717075 |
ttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
53717004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9446323 - 9446145
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||| ||||||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
9446224 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
9446223 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataacaaaaccaattttgtagtttttgg |
9446145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 18136014 - 18135936
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
18135936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 49123222 - 49123144
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
49123144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 5063013 - 5063183
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| |||||||||||||||||||| ||| |||||||||| |||||||| | ||||||||||||||||||||| |||| |
|
|
T |
5063013 |
taaaatat-gttttagtccctgcaaatataccttgttttggtttaagtccctg-taaaaaaaattgtttttggtccctgcaaaattttgatttt--gaaa |
5063108 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
5063109 |
atagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtagtttttgg |
5063183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32365094 - 32365273
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
32365094 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
32365193 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
T |
32365194 |
ttaaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtagtttttgg |
32365273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 321 - 396
Target Start/End: Complemental strand, 123793 - 123718
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
396 |
Q |
|
|
||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
123793 |
gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
123718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 3178784 - 3178861
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||| | ||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
T |
3178784 |
gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaattttgtagtttttg |
3178861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 52441763 - 52441939
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
T |
52441763 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
52441861 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||| ||||||||||||||||||||||| ||| | || |||||||| |||||||||||||||| |
|
|
T |
52441862 |
aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtagtttttgg |
52441939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45505894 - 45505713
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg----tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
|
|
T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaattttttttttttgtttttggtccctgcaaatttttttgtt |
45505795 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||| ||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||| |
|
|
T |
45505794 |
ttttaaattagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttgg |
45505713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 2180573 - 2180394
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||| || || |||||||||||||||||| |
|
|
T |
2180573 |
tggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaaaaaaaaaattatttttggtccctgcaaaattttttgtttt |
2180474 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| |||| || |||||||| |||||||||||||||| |
|
|
T |
2180473 |
ttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtagtttttgg |
2180394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 46087860 - 46087936
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
46087860 |
gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaattttgtagtttttgg |
46087936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 22099912 - 22099732
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt |
22099813 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
22099812 |
tttaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
22099732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 50822178 - 50822120
Alignment:
Q |
340 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50822178 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
50822120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 18830946 - 18831023
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||| ||| || |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
T |
18830946 |
gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtagtttttg |
18831023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 27008083 - 27008139
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27008083 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 35415634 - 35415576
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35415634 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 35763647 - 35763704
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 41345853 - 41345910
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13064465 - 13064410
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 52017505 - 52017560
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 50714239 - 50714297
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
50714239 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 333 - 399
Target Start/End: Original strand, 52429825 - 52429891
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
T |
52429825 |
tgaccccatttttgtgatgatttgcatacgtggcacattataacttaataaattttgtagtttttgg |
52429891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 123534 - 123591
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
123534 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 22099542 - 22099595
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22099542 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 23245230 - 23245286
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
23245230 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 29380668 - 29380724
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
29380668 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35464383 - 35464327
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
35464383 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 42848392 - 42848336
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
42848392 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 278
Target Start/End: Complemental strand, 46088060 - 46088004
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46115413 - 46115469
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
46115413 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46128547 - 46128603
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
46128547 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2034855 - 2034800
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
2034855 |
ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2180220 - 2180275
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8760604 - 8760659
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
8760604 |
ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13479611 - 13479556
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13530713 - 13530658
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
13530713 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24774045 - 24774100
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
24774045 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29499182 - 29499237
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29499182 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30046792 - 30046737
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
30046792 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30061133 - 30061078
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
30061133 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32365483 - 32365428
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43231389 - 43231334
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
43231389 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45505600 - 45505655
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 23778964 - 23779014
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 28809180 - 28809126
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 6827546 - 6827603
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
T |
6827546 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggt |
6827603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 9289639 - 9289582
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
9289639 |
ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 392
Target Start/End: Complemental strand, 29420537 - 29420365
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg--tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
T |
29420537 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattttttttattgttttttatccctgcaaaatattttgtttt |
29420438 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||| || ||||||||||||||||||| |||||||||||||||| || | |||||| ||||||||| |
|
|
T |
29420437 |
tgaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag |
29420365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 51708693 - 51708750
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
51708693 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggt |
51708750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 4211561 - 4211617
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
4211561 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 5052584 - 5052532
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5052584 |
ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 8191392 - 8191336
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
T |
8191392 |
tggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 13073758 - 13073814
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13073758 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 26412585 - 26412529
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26412585 |
tggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 29380910 - 29380858
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 34361803 - 34361855
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46292391 - 46292447
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
T |
46292391 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5827973 - 5827918
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
5827973 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5882552 - 5882606
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
5882552 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8760781 - 8760726
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
8760781 |
ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 11692870 - 11692929
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||| || |||||||| |||| |
|
|
T |
11692870 |
gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacccattt |
11692929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12791974 - 12791919
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
12791974 |
ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13631228 - 13631283
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13631228 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13631599 - 13631544
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13631599 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14487802 - 14487857
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
T |
14487802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
14791806 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25423924 - 25423979
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25423924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25424312 - 25424257
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25424312 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35464018 - 35464073
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35464018 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43231088 - 43231143
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
43231088 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46115779 - 46115724
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||| | |||||||||||||||||||||| |
|
|
T |
46115779 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46128913 - 46128858
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||| | |||||||||||||||||||||| |
|
|
T |
46128913 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 46292651 - 46292600
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 47274231 - 47274180
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
47274231 |
tggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 51545629 - 51545680
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
51545629 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 52430100 - 52430045
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 52442092 - 52442037
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
52442092 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 53915683 - 53915738
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
53915683 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 54903475 - 54903420
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
T |
54903475 |
ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 32208901 - 32208847
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
T |
32208901 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||||||| |||||| |||||||||||||||||||||||||||| |
|
|
T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
7642544 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
7642491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 43368467 - 43368644
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttta |
43368566 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||| |||| |||||||||||||||||||||||| || | |||| ||| ||||||||||||||| |
|
|
T |
43368567 |
aaatagtcgttgaccccatttttatgatgatttgcatacgtggcacataatgaatgaacccatttttgtagtttttgg |
43368644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg |
51830944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5827654 - 5827710
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
5827654 |
tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13074125 - 13074073
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
13074125 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 19321860 - 19321804
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
19321860 |
tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 25358460 - 25358396
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||| || ||||||| ||||||||| |
|
|
T |
25358460 |
gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag |
25358396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 28809010 - 28809066
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
28809010 |
tggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31560696 - 31560640
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
31560696 |
tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 41324891 - 41324835
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
T |
41324891 |
tggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 53308069 - 53308013
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
T |
53308069 |
tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 53716921 - 53716973
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || |||||||||||||||| |
|
|
T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4279022 - 4279077
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
T |
4279022 |
ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 5797711 - 5797652
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
5797711 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5797652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11693121 - 11693066
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
11693121 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12152493 - 12152438
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
12152493 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 13530488 - 13530547
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
13530488 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
13530547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14488187 - 14488132
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
14488187 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 20291986 - 20292037
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
T |
20291986 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 22584287 - 22584338
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||| |
|
|
T |
22584287 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23245595 - 23245540
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
23245595 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23779225 - 23779170
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
T |
23779225 |
ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 25424203 - 25424144
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
25424203 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
25424144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26412190 - 26412245
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
26412190 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27427872 - 27427926
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||| |||||||||||||||||||||| |
|
|
T |
27427872 |
ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 28448834 - 28448885
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
T |
28448834 |
ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31560331 - 31560386
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
31560331 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31812213 - 31812158
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||||||||||| |||||||||||||||||||||| |
|
|
T |
31812213 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34355283 - 34355228
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
34355283 |
ggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35119292 - 35119347
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| |||||||||||||||||||| |
|
|
T |
35119292 |
ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36054150 - 36054095
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
36054150 |
ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42848027 - 42848082
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||||||||||| |||||||||||||||||||||| |
|
|
T |
42848027 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 45474596 - 45474545
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45593586 - 45593531
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
T |
45593586 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 53916047 - 53915992
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
53916047 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 2034552 - 2034594
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
2034552 |
ttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||||| |||||||||||||||||||||||||| |||| |
|
|
T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
5827764 |
gtccctgaccccacttttgtgatgatttgcatatgtggcacat |
5827806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||| | |||||||||||||||||||||||||||||||| |
|
|
T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 279
Target Start/End: Complemental strand, 123893 - 123840
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagt-ccctggt |
279 |
Q |
|
|
|||||| ||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggt |
123840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 11285605 - 11285682
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| |||||||||||||||||||| ||||| | || |||| | | |||||||||||||||| |
|
|
T |
11285605 |
aaaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtagtttttgg |
11285682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 29463609 - 29463658
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
T |
29463609 |
tggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
51738362 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
51738309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 55805089 - 55805036
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||||||||| || | ||||||||||||| |||||||||||||||| |
|
|
T |
55805089 |
tggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcg-ttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 24474600 - 24474651
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
24474600 |
ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 25358541 - 25358485
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
25358541 |
tggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2322432 - 2322377
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
T |
2322432 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4211610 - 4211669
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
T |
4211610 |
gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
4211669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12152154 - 12152209
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
12152154 |
ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13530379 - 13530434
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
T |
13530379 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18136113 - 18136058
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
T |
18136113 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19321570 - 19321625
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
T |
19321570 |
ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19903261 - 19903316
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| |
|
|
T |
19903261 |
ggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctg |
19903316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 24774318 - 24774259
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
24774318 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24774259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26314332 - 26314277
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
T |
26314332 |
ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31182504 - 31182449
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| | |||||||||||| ||||||||||||| |||||||| |
|
|
T |
31182504 |
ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31811925 - 31811980
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
31811925 |
ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 34354972 - 34355020
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
34354972 |
taaaatatagttttagtccctgca----tgcctcgttttggttttagtccctg |
34355020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
36050402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 36050395 - 36050454
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| |||||||| || || |||||||| |||| |
|
|
T |
36050395 |
gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt |
36050454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37556841 - 37556896
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||| || ||||||||| ||||| ||||||||||||||||| |
|
|
T |
37556841 |
ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42823776 - 42823831
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
42823776 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 44925485 - 44925536
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
44925485 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47023105 - 47023050
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
47023105 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 47135887 - 47135942
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
T |
47135887 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacca |
47135942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 49123321 - 49123266
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
T |
49123321 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51738137 - 51738192
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
T |
51738137 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg |
51738192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 51738411 - 51738356
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| |||||||||||||||||||| |||| ||||||| |
|
|
T |
51738411 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 238 - 277
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
Q |
238 |
tagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctg |
54208516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 54208716 - 54208657
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
54208716 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
54208657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 11692762 - 11692816
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||| | ||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
11692762 |
ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||| |||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
T |
12791865 |
gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
12791811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 31370804 - 31370854
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
T |
31370804 |
ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 8191288 - 8191216
Alignment:
Q |
322 |
aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||| | ||||||||||||||||||||| |||| | ||||||| ||||||||| |
|
|
T |
8191288 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag |
8191216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||| ||| ||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
14488078 |
gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac |
14488025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||| |||||||||| | ||||||||||||||||||| |
|
|
T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||| |||||||||| |||| ||||||||||||||||| |
|
|
T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 333 - 382
Target Start/End: Original strand, 41439902 - 41439951
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||| ||||||||||||||||||| ||||||||||| || |||||||| |
|
|
T |
41439902 |
tgaccctacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
41439951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 42824092 - 42824039
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| || |||||| ||||||||| |
|
|
T |
42824092 |
tggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13764807 - 13764755
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||| |||||||||||||||||| |
|
|
T |
13764807 |
ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14594206 - 14594258
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||| |
|
|
T |
14594206 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 358
Target Start/End: Complemental strand, 14791759 - 14791727
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgca |
358 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
14791759 |
tagtccctgaccccacttttgtgatgatttgca |
14791727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 20144731 - 20144683
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
T |
20144731 |
ggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26313987 - 26314043
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
26313987 |
tggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 29380717 - 29380769
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||| |||||||||||| |||||||||| ||||||||||| || |||||| |
|
|
T |
29380717 |
gtccctggccccacttttgtaatgatttgcacacgtggcacatgatgactgaa |
29380769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 35119611 - 35119559
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||| ||||||||||| ||||||||||||| ||||| |
|
|
T |
35119611 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 392
Target Start/End: Original strand, 46292441 - 46292505
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||| ||||| || ||| || | ||||||||| |
|
|
T |
46292441 |
gtccctgcccccacttttgtgatgatttgcacacgtgacacatgatgactaaatccattttgtag |
46292505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||||||| ||||||| || |||||||||||||||||| |
|
|
T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| ||||||||||||||| |
|
|
T |
52543422 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 8905235 - 8905180
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| ||||||| ||||||||||| ||||| ||||| ||||| |
|
|
T |
8905235 |
tggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 223 - 254
Target Start/End: Original strand, 12791610 - 12791641
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatg |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
12791610 |
gctaaaatatagttttagtccctgcaaatatg |
12791641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 19903370 - 19903429
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| || |||||||||||||||||||| | ||||||||| || | ||||||||||| |
|
|
T |
19903370 |
gtccctggccacacttttgtgatgatttgcacatgtggcacatgatgagtgaaccaattt |
19903429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 24774354 - 24774311
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
24774311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 25358497 - 25358454
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||| |||||||||||| | ||||||| |
|
|
T |
25358497 |
gttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 31811996 - 31812039
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
31812039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 35119380 - 35119431
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| |||||| |||| || |||||||| |||| |
|
|
T |
35119380 |
ccccacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt |
35119431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||| ||||| ||||||| |
|
|
T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 42848282 - 42848227
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
T |
42848282 |
gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca |
42848227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46115670 - 46115611
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
T |
46115670 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46115611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46128804 - 46128745
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
T |
46128804 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
46128745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 47022996 - 47022937
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | |||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
47022996 |
gtccctggctccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
47022937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 47135851 - 47135894
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
47135894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51762870 - 51762925
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| || || ||| |||||||||||| || |||||||||||||||||| |
|
|
T |
51762870 |
ggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg |
51762925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 51763129 - 51763086
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
51763086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 338 - 380
Target Start/End: Complemental strand, 2034735 - 2034693
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
T |
2034735 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
2034693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctg |
11692876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 381
Target Start/End: Complemental strand, 28449123 - 28449065
Alignment:
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| | |||||||| |||||||||||||||||||| ||||| || || ||||||| |
|
|
T |
28449123 |
aaatagttcatgaccccatttttgtgatgatttgcatacatggcatatgatgactgaac |
28449065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 47023027 - 47022989
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
47023027 |
gtccctgcaaatatgcctcattttggttttggtccctgg |
47022989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 277
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||| ||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 54208747 - 54208709
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
54208747 |
gtccctgcaaatatgcctcattttggttttggtccctgg |
54208709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 332 - 369
Target Start/End: Complemental strand, 12152380 - 12152343
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcaca |
369 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||| |
|
|
T |
12152380 |
ctgaccccacttttgtgatgatttgcactcgtggcaca |
12152343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| |||||||||| || |||||||| |||||||||||||||||| |
|
|
T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||| ||||| || ||||||| |
|
|
T |
50754146 |
gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac |
50754094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||| ||||||||||||||| ||| |||||||||||||||| |
|
|
T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 331 - 383
Target Start/End: Original strand, 19321682 - 19321734
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
|||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
T |
19321682 |
cctgactccacttttgtgataatttgcacacgtgacacatgatgactgaacca |
19321734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||| ||||| |||||||||| |||||||| ||||||||||||||| |
|
|
T |
20292284 |
aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc |
20292237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 28449214 - 28449166
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| ||||||||| ||||| |
|
|
T |
28449214 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 43368778 - 43368722
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||| | || ||||||||| |||||||||||||||| |||| |
|
|
T |
43368778 |
tggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctg |
43368722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 52543620 - 52543568
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
|||| ||||||||||||| |||||||||||| ||||| ||||| || |||||| |
|
|
T |
52543620 |
gtccatgaccccacttttctgatgatttgcacacgtgtcacatgatgactgaa |
52543568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 52642181 - 52642129
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||| ||||||| ||||||||| ||||||||| || | |||||||||||||| |
|
|
T |
52642181 |
tggcttaaatatatttttagtccttgcaaatataccactttttggttttagtc |
52642129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Complemental strand, 54903359 - 54903315
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||||||||||||||||| |||| ||||| ||||||||| |
|
|
T |
54903359 |
ccccacttttgtgatgatttgcaagcgtgacacataataactgaa |
54903315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 289 - 110
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
289 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
190 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
189 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 101; Significance: 6e-50; HSPs: 231)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 221 - 397
Target Start/End: Original strand, 4375691 - 4375867
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
4375691 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
4375790 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4375791 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
4375867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 4016906 - 4017082
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| | |
|
|
T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaaaaaaaaatgtttttggtccctgcaaaattttttgtttttta |
4017005 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4017006 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
4017082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 395
Target Start/End: Original strand, 19494119 - 19494294
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
19494119 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggttt |
19494218 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
395 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19494219 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
19494294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38930302 - 38930481
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||| ||||||| ||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
38930302 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
38930401 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38930402 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
38930481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 1525809 - 1525989
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
1525908 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1525909 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtagtttttgg |
1525989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33636322 - 33636502
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
33636322 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaattttttgttt |
33636421 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
33636422 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtagtttttgg |
33636502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 16644044 - 16643864
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaattttttgttt |
16643945 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
16643944 |
ttgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttgg |
16643864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 223 - 399
Target Start/End: Complemental strand, 6146948 - 6146769
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaatttttttgtttt |
6146849 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6146848 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
6146769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 28399035 - 28398860
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
28399035 |
ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg--taaaaaaattgtttttggtccctgcaaaattttttgtttttg |
28398938 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
28398937 |
aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
28398860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 1162908 - 1163091
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
1162908 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtg |
1163007 |
T |
 |
Q |
318 |
nnn--gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
1163008 |
tttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
1163091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8094479 - 8094659
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
8094479 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaattttttgttt |
8094578 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
8094579 |
ttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
8094659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 16789370 - 16789194
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||| |
|
|
T |
16789370 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtcccagcaaaattttgtttt-- |
16789273 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
16789272 |
-gaatatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
16789194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 24187569 - 24187746
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |||||||||| || |||||| | |
|
|
T |
24187569 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaattgtttttggcccgtgcaaatttttttgtttttg |
24187668 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
24187669 |
aaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtagtttttgg |
24187746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 10776500 - 10776319
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||| |
|
|
T |
10776500 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaattttttgtt |
10776401 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
10776400 |
tttgaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtagtttttgg |
10776319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 384
Target Start/End: Original strand, 40492960 - 40493117
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||| |||||||||||| |||||||||||||||||||||| || |||||||||||||||||| | |
|
|
T |
40492960 |
ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg-----taattttttttttggtccctgcaaaattttttgtttttg |
40493054 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
384 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40493055 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
40493117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1408353 - 1408175
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttattttt |
1408254 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
T |
1408253 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaattttatagtttttgg |
1408175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 24955010 - 24954832
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| || || |||||||||| ||||||| |
|
|
T |
24955010 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaaaaaaaattatttttggtccttgcaaaaaaatttgttttt |
24954911 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
24954910 |
gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataacaaaaccaattttgtagtttttgg |
24954832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 6146517 - 6146694
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||| | |
|
|
T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
6146616 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
T |
6146617 |
aaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattaggttgtttttgg |
6146694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 21509796 - 21509873
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtagtttttg |
21509873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14495299 - 14495221
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtagtttttgg |
14495221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22650464 - 22650646
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt-----tgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaataatattgtttttggtccctgcaaaattttttgt |
22650563 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
22650564 |
ttttgaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtagtttttgg |
22650646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 22917826 - 22917748
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
22917748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 25131210 - 25131288
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
25131210 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
25131288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 27341591 - 27341411
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttgttt |
27341492 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27341491 |
ttgaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaattttgtagtttttgg |
27341411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 21125919 - 21125842
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
21125919 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
21125842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 40066497 - 40066673
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||| ||||||| | |
|
|
T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaaaaaaaaattgtttttggtcc-tgcaaaattttttgtttttg |
40066595 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
T |
40066596 |
aaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttataatttttgg |
40066673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 7272420 - 7272600
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||| ||| |
|
|
T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaagaaaattttgtttttggtccctgctaaataatttgttt |
7272519 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7272520 |
ttgaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtagtttttgg |
7272600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14488716 - 14488894
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| || ||||||||||| |||||| |
|
|
T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaaaaaaaaatttgtttttggtccttgcaaatttttttgttttt |
14488815 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||| || |||||||| |||||||||||||||| |
|
|
T |
14488816 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagtttttgg |
14488894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 32040272 - 32040195
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
T |
32040272 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtagtttttg |
32040195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 225 - 379
Target Start/End: Original strand, 1685117 - 1685274
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||| | |
|
|
T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtcactgcaaaattttttgcttttg |
1685216 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga |
379 |
Q |
|
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1685217 |
aaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga |
1685274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 33526051 - 33526232
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| ||| |||||||||||||| || | ||||||||||||||||||||| |
|
|
T |
33526051 |
tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtccatgtgaatttttttgtttgtttttggtccctgcaaaattttttgtt |
33526150 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||| |
|
|
T |
33526151 |
ttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttgg |
33526232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 15719758 - 15719835
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
15719758 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg |
15719835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14238751 - 14238929
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtcc-tgcaaaattatttgtttt |
14238849 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
T |
14238850 |
ttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtagtttttgg |
14238929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29158354 - 29158534
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaattttttgttt |
29158453 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| || |||||||||||||||| |||| ||||||| |||| ||||||||||||||||||||||||||||| |
|
|
T |
29158454 |
ttgaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaattttgtagtttttgg |
29158534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29488110 - 29487932
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgttttt |
29488011 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||| || |||||||| ||||||||||||||| |
|
|
T |
29488010 |
taaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtagtttttgg |
29487932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 19963099 - 19963176
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||| | || ||||||||||| |||||||||||||||| |
|
|
T |
19963099 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtagtttttgg |
19963176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 14496816 - 14496991
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||| ||||||||||||| |||||||||||||||||||| | ||||||||||||| ||||||| | |
|
|
T |
14496816 |
ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtcccta-taaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
14496914 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||| |||||||||| || ||||||||||||||||||| ||||||||| || |||||||| |||||||| |||||| |
|
|
T |
14496915 |
aaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttg |
14496991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 18549305 - 18549383
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||| |
|
|
T |
18549305 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtagtttttgg |
18549383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 30337023 - 30337101
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||| | || || |||||||| |||||||||||||||| |
|
|
T |
30337023 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtagtttttgg |
30337101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 10755429 - 10755352
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||| ||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
10755429 |
aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
10755352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19494413 - 19494356
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 22917564 - 22917621
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 32418577 - 32418500
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||| |
|
|
T |
32418577 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttgg |
32418500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 43477411 - 43477334
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||| | ||||| || |||||||| |||||||||||||||| |
|
|
T |
43477411 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtagtttttgg |
43477334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 43727328 - 43727251
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||| ||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
43727328 |
aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtagtttttgg |
43727251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4621355 - 4621299
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14239080 - 14239025
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21125719 - 21125774
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43477163 - 43477218
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35143844 - 35143667
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||| ||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35143844 |
ggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctgaaaaaaaaaaattgtttttggtccctgcaaaattttttattttt |
35143745 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||| ||||| ||||| ||||| |||||||||| |
|
|
T |
35143744 |
taaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaaccgattttatagtttttgg |
35143667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 1526172 - 1526115
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 7578429 - 7578352
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||| | ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
7578429 |
aaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
7578352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 16643661 - 16643718
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 40844434 - 40844357
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| || | ||| || |||||||||||||||| |
|
|
T |
40844434 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtagtttttgg |
40844357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 2728598 - 2728542
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
2728598 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7272752 - 7272696
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
7272752 |
tggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7326422 - 7326366
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
7326422 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 32418318 - 32418370
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35097693 - 35097637
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
35097693 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40066821 - 40066765
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
40066821 |
tggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40844155 - 40844211
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
40844155 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4017300 - 4017245
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
4017300 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4710220 - 4710165
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
4710220 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11019857 - 11019802
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
11019857 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11976373 - 11976428
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
11976373 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14495069 - 14495124
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 25131448 - 25131393
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
25131448 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28346394 - 28346449
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
28346394 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28346758 - 28346703
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
28346758 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32726271 - 32726216
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
32726271 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33526412 - 33526357
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33526412 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 34963300 - 34963355
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
34963300 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37536086 - 37536141
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
37536086 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 8094841 - 8094788
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
8094841 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 38930664 - 38930607
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
38930664 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1778563 - 1778619
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
1778563 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7186005 - 7185949
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
7186005 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 8298586 - 8298642
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8298586 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 10873281 - 10873225
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
10873281 |
tggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 14489074 - 14489018
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
14489074 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34963665 - 34963609
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
34963665 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35346628 - 35346684
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35346628 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 37536420 - 37536364
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
37536420 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 42133155 - 42133099
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
42133155 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3511906 - 3511961
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
T |
3511906 |
ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3512266 - 3512211
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3512266 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4474044 - 4473989
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
4474044 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7326086 - 7326141
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7326086 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7420230 - 7420285
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
7420230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 7420590 - 7420535
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
7420590 |
ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8298975 - 8298920
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8298975 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9496723 - 9496668
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
9496723 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10337119 - 10337174
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
10337119 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10337449 - 10337394
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
10337449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10540782 - 10540727
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10540782 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10872915 - 10872970
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
10872915 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11019520 - 11019575
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11019520 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13154886 - 13154941
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
13154886 |
ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16789075 - 16789130
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 18549201 - 18549252
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20277692 - 20277747
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
20277692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20984146 - 20984201
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
20984146 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21064319 - 21064374
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
21064319 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21126021 - 21125966
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||| || ||||||| |||||||||||||||||||||| |
|
|
T |
21126021 |
ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24187897 - 24187842
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
24187897 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25131111 - 25131166
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25600597 - 25600542
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 28497363 - 28497422
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
28497363 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
28497422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32725907 - 32725962
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
32725907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35097328 - 35097383
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35097328 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 35115590 - 35115531
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||| |
|
|
T |
35115590 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
35115531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35345617 - 35345562
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||| |||||||||||||||||||||||||||| |||||| |
|
|
T |
35345617 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35346998 - 35346943
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35346998 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 5357423 - 5357477
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
5357423 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 10540449 - 10540503
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10540449 |
ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 15719655 - 15719709
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
15719655 |
tggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 28323849 - 28323903
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||| |||||||||||||||||| |||||||||||||||||||| |
|
|
T |
28323849 |
ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 268
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
268 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||||| || |||||||| |||||||||||||||||||||||||||||| |
|
|
T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 20278057 - 20278005
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
20278057 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 21064684 - 21064632
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
21064684 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 42132863 - 42132919
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
42132863 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2728232 - 2728287
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
2728232 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4473704 - 4473759
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
T |
4473704 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6469280 - 6469335
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| | ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
6469280 |
ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 8298696 - 8298755
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
8298696 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
8298755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9496341 - 9496396
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
9496341 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 13232563 - 13232512
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||| ||||||||||||| |
|
|
T |
13232563 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17073807 - 17073862
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
17073807 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17574463 - 17574408
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
17574463 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20984510 - 20984455
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
T |
20984510 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25600230 - 25600285
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
25600230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 321 - 392
Target Start/End: Original strand, 32195381 - 32195452
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||| |||||||||||||| ||||||| |||||||||| ||||| || | |||||| ||||||||| |
|
|
T |
32195381 |
gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacatgatgattgaacctattttgtag |
32195452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35115639 - 35115584
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
T |
35115639 |
ggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 1163275 - 1163217
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| |||||||||| |||||||||||| |||||| ||||||||| ||||| |
|
|
T |
1163275 |
tggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggt |
1163217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| | ||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 27117976 - 27117922
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
T |
27117976 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 267
Target Start/End: Complemental strand, 40493158 - 40493112
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtt |
267 |
Q |
|
|
|||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
T |
40493158 |
tggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| ||||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
T |
20277801 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
20277854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| ||||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
T |
21064428 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
21064481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 29158670 - 29158617
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
29158670 |
tggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||||||| |||||||||||||||||||||||||| |
|
|
T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28497255 - 28497307
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
T |
28497255 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 333 - 388
Target Start/End: Original strand, 2811555 - 2811610
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||| || ||| |||| ||||| |
|
|
T |
2811555 |
tgaccccacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt |
2811610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3680801 - 3680746
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||||||||||||| ||||||| |
|
|
T |
3680801 |
ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 4376010 - 4375960
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 6469557 - 6469498
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| |||| | |||||||||||||| |||||||| |||| |
|
|
T |
6469557 |
gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacccattt |
6469498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 7326195 - 7326254
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
7326195 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7326254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
7420346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 7420339 - 7420398
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
7420339 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7420398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9175012 - 9175067
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||| |||||||||| |||||||||||||||||||||| |
|
|
T |
9175012 |
ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13155251 - 13155196
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||||||||||| ||||||||||||||| |||||| |
|
|
T |
13155251 |
ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
13232314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19962995 - 19963050
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| || ||||||| |||||||||| |||||||| ||||||||||||| |
|
|
T |
19962995 |
ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
20277808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
21064435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 326 - 381
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||||||||||||||| | ||| ||||| || ||||||| |
|
|
T |
23939654 |
tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac |
23939709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 227 - 274
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||| ||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24815068 - 24815013
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| | ||||||||||||| ||| |||||||||||||||||| |
|
|
T |
24815068 |
ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25702512 - 25702567
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| |||||||||||||||| |||||||||||| |
|
|
T |
25702512 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27117753 - 27117808
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
T |
27117753 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28324181 - 28324126
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| || ||||||||||||||||||| |
|
|
T |
28324181 |
ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 29992192 - 29992133
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||| ||||| || |||||||| |||| |
|
|
T |
29992192 |
gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
29992133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29992300 - 29992245
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||| |||||||||||||||||||||||| |||||||||||| |
|
|
T |
29992300 |
ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 31445463 - 31445412
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
T |
31445463 |
ggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32040075 - 32040130
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| | |||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32040075 |
ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 42430011 - 42429952
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||| ||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
42430011 |
gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
42429952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctgg |
42430004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 271
Target Start/End: Original strand, 1408004 - 1408054
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag |
271 |
Q |
|
|
|||||||||||| |||||||||| |||||||||| |||||||| ||||||| |
|
|
T |
1408004 |
tggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2355887 - 2355941
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||||| ||| ||||||||||||| ||| |||||||||||||||||| |
|
|
T |
2355887 |
ggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccct |
2355941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
Q |
227 |
aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| |||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttg |
264 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 387
Target Start/End: Complemental strand, 15931155 - 15931101
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
15931155 |
tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt |
15931101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 387
Target Start/End: Complemental strand, 9175257 - 9175204
Alignment:
Q |
334 |
gaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
T |
9175257 |
gaccccacttttgtgatgatttgcacacatggcacatgatgactgaacccattt |
9175204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg |
13779204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 258
Target Start/End: Original strand, 28398755 - 28398792
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctc |
258 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
T |
28398755 |
tggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 29487749 - 29487802
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
29487749 |
tggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||||||||||||||||| | |||||| ||||||| |||| |
|
|
T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 1778673 - 1778725
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||| |
|
|
T |
1778673 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
1778725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 388
Target Start/End: Complemental strand, 10873172 - 10873112
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
||||||| | ||| ||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
T |
10873172 |
gtccctggctccaattttgtgatgatttgcacacgtggcacatgatgactgaacccatttt |
10873112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 13154995 - 13155047
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
|||||||||||||||||||| ||||||||| ||||||||||| || |||||| |
|
|
T |
13154995 |
gtccctgaccccacttttgtattgatttgcacacgtggcacatgatgactgaa |
13155047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 24814814 - 24814866
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
|||||||||||||||||||| |||||||||| |||| |||||| || |||||| |
|
|
T |
24814814 |
gtccctgaccccacttttgttatgatttgcacacgtagcacatgatgactgaa |
24814866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 28258241 - 28258189
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||| | ||||||||||| ||||||||||||||||||| |
|
|
T |
28258241 |
ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||| |||||||||||||||||||| ||||||||| |
|
|
T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 44997931 - 44997979
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
T |
44997931 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctg |
1778874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4473777 - 4473820
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
4473777 |
ttttagtccctgcaaatatgccttattttggttttggtccctgg |
4473820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4473813 - 4473872
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
T |
4473813 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
4473872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 10540522 - 10540565
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
10540565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 11976627 - 11976572
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
11976627 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
11976572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 13232307 - 13232366
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
13232307 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
13232366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 241 - 276
Target Start/End: Original strand, 14847844 - 14847879
Alignment:
Q |
241 |
tccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| |
|
|
T |
14847844 |
tccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 326 - 381
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||| |||||||| |||||||||||| ||||| ||||| || ||||||| |
|
|
T |
17074061 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 326 - 381
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||| |||||||| |||||||||||| ||||| ||||| || ||||||| |
|
|
T |
17574209 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17574264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 23939546 - 23939597
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| ||| ||||||||||| |||||||| |||||||| |
|
|
T |
23939546 |
tggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26530668 - 26530723
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| |||||||||| |||||||||||||| |||| |||||||| |||| |
|
|
T |
26530668 |
ggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||| ||||| |||||||||||| || ||||||||||||||| |
|
|
T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42429758 - 42429812
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
T |
42429758 |
ggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 10540558 - 10540600
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| |
|
|
T |
10540558 |
gtccctggctccacttttgtgatgatttgcacacgtggcacat |
10540600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 13779426 - 13779384
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||| |||||||||||||||||||||||||| | ||||||||| |
|
|
T |
13779426 |
gtccatgaccccacttttgtgatgatttgcacatgtggcacat |
13779384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||| || ||| |||||||| |||||||||||||||||||||| |
|
|
T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| |||||||||||||||||| |||||||||||| |
|
|
T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||| | |||||||| ||||||||||||||||||||| |
|
|
T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 338 - 380
Target Start/End: Complemental strand, 44998146 - 44998104
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
T |
44998146 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
44998104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 258
Target Start/End: Complemental strand, 30969718 - 30969681
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctc |
258 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
30969718 |
tggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 42132973 - 42133026
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| | ||||||||||||||||||||| || |||||||| || ||||||| |
|
|
T |
42132973 |
gtccctggctccacttttgtgatgatttgcacacctggcacatgatgactgaac |
42133026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 44998264 - 44998211
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||| || || |||||||| ||||||||||||||||||| |
|
|
T |
44998264 |
tggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 331 - 387
Target Start/End: Original strand, 2355997 - 2356053
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| |||||||||||||||||||| || || ||||| || |||||||| |||| |
|
|
T |
2355997 |
cctgacctcacttttgtgatgatttgcacacatgacacatgatgactgaacccattt |
2356053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
Q |
245 |
tgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 364
Target Start/End: Complemental strand, 5357654 - 5357618
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtg |
364 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
5357654 |
gtccctgactccacttttgtgatgatttgcacacgtg |
5357618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 13796577 - 13796541
Alignment:
Q |
241 |
tccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
T |
13796577 |
tccctgcaaatatgtctcattttggttttagtccctg |
13796541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 243 - 275
Target Start/End: Complemental strand, 14848169 - 14848137
Alignment:
Q |
243 |
cctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
14848169 |
cctgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #230
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 15719979 - 15719931
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||| ||||||| ||||||||||| || |||||||||||| |
|
|
T |
15719979 |
ggctaaaatataattttagtttctgcaaatatgtcttgttttggtttta |
15719931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #231
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 27341258 - 27341310
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||| ||||||||||||||| |||||| ||||||||| |
|
|
T |
27341258 |
ggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtcc |
27341310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 101; Significance: 6e-50; HSPs: 181)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 7155797 - 7155976
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
7155896 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7155897 |
tgaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
7155976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 33801743 - 33801564
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttt |
33801644 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33801643 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
33801564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 31166871 - 31167049
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccctgcaaaattttttgttttt |
31166970 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31166971 |
gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
31167049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 15076204 - 15076025
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
15076105 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
15076104 |
tgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
15076025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8680775 - 8680955
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8680775 |
ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
8680874 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8680875 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg |
8680955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 221 - 398
Target Start/End: Original strand, 34582528 - 34582708
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
34582528 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttttgtt |
34582627 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34582628 |
tttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
34582708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32885673 - 32885852
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32885673 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
32885772 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32885773 |
tgaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
32885852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 24692979 - 24692802
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||| |||||||| | |
|
|
T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgcaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg |
24692880 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
24692879 |
aaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtagtttttgg |
24692802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 30929045 - 30928867
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| |
|
|
T |
30929045 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt |
30928946 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
T |
30928945 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttg |
30928867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 317812 - 317988
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
T |
317812 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg-taaaaaaaattgtttttggtccctgcaaatttttttgtttttt |
317910 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
317911 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
317988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 543724 - 543544
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| | |||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
543724 |
ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaattttttattt |
543625 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
543624 |
ttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttgg |
543544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14655669 - 14655591
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
14655591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 15962027 - 15962207
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
15962027 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
15962126 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
15962127 |
ttggaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttgg |
15962207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 24273939 - 24274017
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
24274017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 225 - 398
Target Start/End: Original strand, 10091039 - 10091212
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaa |
10091138 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
T |
10091139 |
atagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttatagtttttg |
10091212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 19296408 - 19296227
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||| |||| |
|
|
T |
19296408 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaagaaaattttgttttcggtccctggaaaattttttgtt |
19296309 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
19296308 |
tttgaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtagtttttgg |
19296227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 3356495 - 3356322
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa |
324 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |||| |||| |
|
|
T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcccta-taaaaaaaattgtttttggtccctggaaaattttttgtttttgaaa |
3356397 |
T |
 |
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| ||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
3356396 |
atagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaattttgtcgtttttgg |
3356322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 778042 - 777861
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||| |||||||| ||||| ||||||||||||||| ||||| |
|
|
T |
778042 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggtaaaaaaaaaaaattgtttttggtccctacaaaattttttgtt |
777943 |
T |
 |
Q |
318 |
nnngaaaatagtccc-tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
777942 |
tttgaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
777861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 1890062 - 1890239
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| ||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | |
|
|
T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
1890161 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||||||| |
|
|
T |
1890162 |
aaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttgg |
1890239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 494661 - 494583
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
494661 |
gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtagtttttgg |
494583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 2616134 - 2616056
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
2616134 |
gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
2616056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 398
Target Start/End: Complemental strand, 7324189 - 7324015
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattgtttttt-- |
7324092 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
7324091 |
aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaattttgtagtttttg |
7324015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 15116773 - 15116851
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
15116773 |
gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
15116851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17321453 - 17321375
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttgg |
17321375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17321586 - 17321508
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttgg |
17321508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 391
Target Start/End: Complemental strand, 31398440 - 31398370
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta |
391 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta |
31398370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 11129302 - 11129379
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaattttttagtttttg |
11129379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 224 - 398
Target Start/End: Complemental strand, 6591440 - 6591263
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||| |||||||| |||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
6591341 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||| |||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
T |
6591340 |
taaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttg |
6591263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26375693 - 26375871
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
T |
26375693 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaattgtttttgttccctgcaaaattttttgttttt |
26375792 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
T |
26375793 |
taaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttgg |
26375871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 6468570 - 6468493
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
T |
6468570 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtagtttttgg |
6468493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 19276036 - 19275862
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
||||||||||||||||||||| ||||||| |||| |||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttgtttttt--a |
19275939 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
19275938 |
aaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg |
19275862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 21995167 - 21995244
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
21995167 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg |
21995244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 242 - 399
Target Start/End: Original strand, 5286606 - 5286768
Alignment:
Q |
242 |
ccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgacccc |
339 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattatttgtttttgaaaatagtccctggcccc |
5286705 |
T |
 |
Q |
340 |
acttttgtgatgatttgcatacgt---ggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
T |
5286706 |
acttttgtgatgatttgcatatgtggcggcacattataaatgaaccaattttgtagtttttgg |
5286768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 223 - 389
Target Start/End: Original strand, 14428651 - 14428818
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttt |
14428750 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
389 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||| |
|
|
T |
14428751 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg |
14428818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 7156160 - 7156103
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7156160 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 24274131 - 24274074
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 15962390 - 15962334
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15962390 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 12612359 - 12612179
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| || ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||| |
|
|
T |
12612359 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccttgcaaaattttttgttt |
12612260 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||| | ||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
12612259 |
tttaaaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
12612179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 494404 - 494457
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
494404 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 226 - 279
Target Start/End: Original strand, 543365 - 543418
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 1890452 - 1890395
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
1890452 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 2373391 - 2373314
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||| | ||||||||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
2373391 |
aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg |
2373314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 8681116 - 8681059
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 12419938 - 12419881
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12419938 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 14655379 - 14655436
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 22822651 - 22822594
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 33131626 - 33131703
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||| | ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
33131626 |
aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtagtttttgg |
33131703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1007509 - 1007454
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1007509 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3414387 - 3414442
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
3414387 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3969009 - 3968954
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
3969009 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 11448537 - 11448720
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc--tggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
11448537 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
11448636 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgca----tacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||| ||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
11448637 |
tgaaaatagtttgtgaccctacttttgtgatgatttgcatacgtacgtgacacattataactgaatcaattttgtagtttttgg |
11448720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21994403 - 21994348
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
21994403 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21995064 - 21995119
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
21995064 |
ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22543354 - 22543409
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
22543354 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25137357 - 25137302
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
25137357 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25431854 - 25431799
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30928681 - 30928736
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34582892 - 34582837
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
34582892 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2615872 - 2615926
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
2615872 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 31167201 - 31167143
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
T |
31167201 |
tggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9896637 - 9896460
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || |||||||||||||||| || ||||||||| ||||||||| | |
|
|
T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtgaaaaaaatttgtttttgctccctgcaagattttttgtttttt |
9896538 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| | || |||| |||| ||||||||||||||||||||| || || |||||||| |||||||||||||||| |
|
|
T |
9896537 |
aaaatagtcaccgatcccatttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtagtttttgg |
9896460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 17771910 - 17771963
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
17771910 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 22792899 - 22792846
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
22792899 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 33808620 - 33808677
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
T |
33808620 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 3356142 - 3356194
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 12419708 - 12419760
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
12419708 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 21995426 - 21995370
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
T |
21995426 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1007124 - 1007179
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1007124 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2373179 - 2373234
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3968645 - 3968700
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3968645 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6412218 - 6412273
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
6412218 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6412579 - 6412524
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6412579 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6468310 - 6468365
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10910964 - 10910909
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
10910964 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11449169 - 11449114
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
T |
11449169 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12299140 - 12299085
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
12299140 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19690393 - 19690448
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19690393 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20467718 - 20467663
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
20467718 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21147404 - 21147459
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
21147404 |
ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21385251 - 21385306
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
21385251 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21385584 - 21385529
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
21385584 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 22543718 - 22543663
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
22543718 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23502540 - 23502485
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24273828 - 24273883
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| |
|
|
T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25136994 - 25137049
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
25136994 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33131850 - 33131795
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
33131850 |
ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 13268109 - 13268163
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
T |
13268109 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 19321131 - 19321081
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
19321131 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 777677 - 777734
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
T |
777677 |
ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt |
777734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 23770400 - 23770343
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
T |
23770400 |
ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttgg |
23770343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3276354 - 3276302
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
3276354 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 369
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca |
369 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
T |
17772014 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca |
17772062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 19129336 - 19129392
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||| ||||| | ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19129336 |
ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg |
19129392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 19267564 - 19267620
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
19267564 |
tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 355 - 399
Target Start/End: Original strand, 22822391 - 22822435
Alignment:
Q |
355 |
tgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22822391 |
tgcaaacgtggcacattataactgaaccaattttgtagtttttgg |
22822435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 24901238 - 24901290
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
24901238 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31186592 - 31186536
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| || ||||||||||||||||||||| ||||||||||||| |
|
|
T |
31186592 |
tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 318097 - 318042
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
318097 |
ggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 494751 - 494700
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||||||||||||||| ||| |
|
|
T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatcc |
494700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1875502 - 1875557
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||| |||| ||||||||||||||||||||||||| ||| ||||||| |
|
|
T |
1875502 |
ggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg |
1875557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 2616240 - 2616193
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3414752 - 3414697
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
3414752 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 6591115 - 6591162
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
6591115 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 8170151 - 8170100
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
8170151 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 12757610 - 12757661
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
12757610 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14656260 - 14656205
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
T |
14656260 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18024375 - 18024320
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
T |
18024375 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19296108 - 19296163
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| || |||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
19296108 |
ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21993787 - 21993842
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
21993787 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
23502237 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 24901347 - 24901406
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||| |||| |
|
|
T |
24901347 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacccattt |
24901406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 30239292 - 30239347
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
30239292 |
tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 17765009 - 17765059
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
17765009 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 22822307 - 22822357
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
T |
22822307 |
ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 25431672 - 25431718
Alignment:
Q |
353 |
tttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
25431672 |
tttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
25431718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| || | ||||||||||||||||||||||||||||||||| |
|
|
T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 31276339 - 31276285
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 13617648 - 13617697
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
T |
13617648 |
ccacttttgtgatgatttgcacacgtggcacatgataactgaacccattt |
13617697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 263
Target Start/End: Complemental strand, 23770439 - 23770398
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgtttt |
263 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 10910628 - 10910684
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||| || |||||||| |||||||||||||||||||||| |
|
|
T |
10910628 |
tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 11129544 - 11129496
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
T |
11129544 |
tggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 31398541 - 31398489
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
T |
31398541 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 12298927 - 12298986
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
T |
12298927 |
gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt |
12298986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13150750 - 13150695
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
T |
13150750 |
ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 15442936 - 15442987
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| |||||||||| ||||||| |
|
|
T |
15442936 |
tggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19129520 - 19129465
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| | |||||||||||||||||||| |
|
|
T |
19129520 |
ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 19320876 - 19320935
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
19320876 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
19320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25121496 - 25121441
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||||||||||| ||||||||||||||||||||| |
|
|
T |
25121496 |
ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 31198724 - 31198783
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
31198724 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
31198783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 1214696 - 1214750
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| | | ||||||||||||||||| |
|
|
T |
1214696 |
ggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 1214996 - 1214942
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| || ||||||||||| ||||||||||||||||||||| |
|
|
T |
1214996 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||| |||||||||||||| ||| |||| ||||||||||||| |
|
|
T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg |
9896333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 365
Target Start/End: Original strand, 13268218 - 13268255
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtgg |
365 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||| |
|
|
T |
13268218 |
gtccctgaccccacttttgtgatgatttgcacacgtgg |
13268255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 366 - 399
Target Start/End: Complemental strand, 33808837 - 33808804
Alignment:
Q |
366 |
cacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
33808837 |
cacattataactgaaccaattttgtagtttttgg |
33808804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 258
Target Start/End: Complemental strand, 15117040 - 15117004
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctc |
258 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |
|
|
T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctggt |
19275179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 1007197 - 1007240
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
1007240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 1214767 - 1214810
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||| || |||||||||||||||||||| |
|
|
T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctgg |
1214810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 3968754 - 3968809
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
3968754 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
3968809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 273
Target Start/End: Complemental strand, 6564932 - 6564893
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
6564932 |
gttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 12611994 - 12612045
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| || |||||||||||||||||||| ||||| |||||||| |
|
|
T |
12611994 |
tggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt |
12612045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14655903 - 14655958
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| || ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg |
14655958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 15116673 - 15116721
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
15116673 |
ggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 15722610 - 15722665
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
T |
15722610 |
ggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 15722719 - 15722778
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||| |||||||||||| |||| ||||||| ||||| ||||| ||||||||||| |||| |
|
|
T |
15722719 |
gtccccgaccccacttttatgatcatttgcacacgtgacacatgataactgaacccattt |
15722778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 15722900 - 15722849
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||||||||| | ||||||||||||||| || |||||||||||| |
|
|
T |
15722900 |
ggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtc |
15722849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17765375 - 17765320
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
17765375 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 379
Target Start/End: Complemental strand, 25121388 - 25121337
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga |
379 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |
|
|
T |
25121388 |
gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactga |
25121337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 25137066 - 25137109
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
25137109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 338 - 381
Target Start/End: Original strand, 31185753 - 31185796
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
31185753 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
31185796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 31198688 - 31198731
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
31198731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 387
Target Start/End: Complemental strand, 23629044 - 23628994
Alignment:
Q |
337 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
T |
23629044 |
cccacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt |
23628994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 25137102 - 25137144
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| |
|
|
T |
25137102 |
gtccctggctccacttttgtgatgatttgcacacgtggcacat |
25137144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 1214801 - 1214862
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| | | ||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
1214801 |
tagtccctggctctacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
1214862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12176384 - 12176437
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||| || || ||||||| |||||||| |||||||||| |
|
|
T |
12176384 |
tggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtcc |
12176437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 19690760 - 19690708
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||| ||||||| ||||| ||||||||||||||| |||||||| |||||||||| |
|
|
T |
19690760 |
tggcgaaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 34990213 - 34990136
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||| |||| ||||||||||||||||| || |||||||| || | ||||| |||| |||||||||| |
|
|
T |
34990213 |
aaaatagtccttgatcccatttttgtgatgatttgcaaacatggcacatgatgattgaactgatttattagtttttgg |
34990136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 7323891 - 7323923
Alignment:
Q |
245 |
tgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
7323891 |
tgcaaatatgtctcgttttggttttagtccctg |
7323923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 11925738 - 11925790
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||| |||| |||| ||||||||||||||| ||||||||| |||||||| |
|
|
T |
11925738 |
tggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtc |
11925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 223 - 267
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtt |
267 |
Q |
|
|
|||||||||| |||||||||||| |||||||| ||| |||||||| |
|
|
T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||| ||||| |||||| |||||||||||| |||||||||| ||||||| |
|
|
T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 213)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 18633962 - 18633781
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
18633962 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt |
18633863 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18633862 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
18633781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36577722 - 36577899
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||| | |
|
|
T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggcccctgcaaaattttttgtttttg |
36577821 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36577822 |
aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
36577899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 6118500 - 6118315
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-------ttgtttttggtccctgcaaaannnnn |
313 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
6118500 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttt |
6118401 |
T |
 |
Q |
314 |
nnnnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6118400 |
tgtttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
6118315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 28550826 - 28551005
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
T |
28550826 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaattgtttttggtccttgcaaaattttttgtttt |
28550925 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
28550926 |
tgaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttgg |
28551005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 223 - 397
Target Start/End: Original strand, 29172524 - 29172701
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt |
29172623 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29172624 |
tgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagttttt |
29172701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35166158 - 35165980
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||| ||||| ||||||||||||||||| ||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
35166158 |
ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaaaaaaaattatttttggtccctgcaaaattttttgttttt |
35166059 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35166058 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
35165980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 5950176 - 5950352
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| | |
|
|
T |
5950176 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaatgtttttggtccctgcaaaattttttgtttttg |
5950274 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
5950275 |
aaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtagtttttgg |
5950352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 15635379 - 15635555
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt--tgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||| |||||||||| |||||||||| || ||||||||||||||||||||| | |||||||||||||||||||| || |
|
|
T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataatgtttttggtccctgcaaaattttttgtttttga |
15635478 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15635479 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
15635555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35167165 - 35166986
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaatttgtttttggtccttgcaaaaatttttgtttt |
35167066 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35167065 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
35166986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5614530 - 5614350
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
5614530 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt |
5614431 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5614430 |
ttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
5614350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 42026892 - 42027007
Alignment:
Q |
99 |
gtttgtgattgttcataatgaagatnnnnnnn-tggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaata |
197 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42026892 |
gtttgtgattgttcataatgaagataaaaaaaatggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaata |
42026991 |
T |
 |
Q |
198 |
tcttacgttatgtaat |
213 |
Q |
|
|
|||||||||||||||| |
|
|
T |
42026992 |
tcttacgttatgtaat |
42027007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29693090 - 29692913
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||| ||||| | |
|
|
T |
29693090 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctacaaaattttttgtttttg |
29692991 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29692990 |
aaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
29692913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 29151515 - 29151696
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||| |||| |
|
|
T |
29151515 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttttgtt |
29151614 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
29151615 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
29151696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 2217854 - 2217678
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgtaaaattttgttttt-- |
2217757 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
2217756 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttgg |
2217678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 42207242 - 42207419
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||| || ||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
42207242 |
ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
42207341 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
42207342 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttg |
42207419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29875400 - 29875579
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
29875400 |
ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaatttttttgtttt |
29875499 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
29875500 |
tgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttgg |
29875579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 30800850 - 30800672
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattttttttttgtttttggtccctgcaaaattttttgttttt |
30800751 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
T |
30800750 |
gaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaattttgaagtttttgg |
30800672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 30888160 - 30888340
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttgttt |
30888259 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
30888260 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtagtttttgg |
30888340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 23382297 - 23382130
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||| | |
|
|
T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct--gtaa--------gtttttggtccctgcaaaattttttgtttttg |
23382208 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
23382207 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
23382130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16616463 - 16616541
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16616463 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
16616541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 21050575 - 21050753
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||| ||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
21050674 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21050675 |
gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
21050753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 27850275 - 27850197
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27850275 |
gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
27850197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 38962992 - 38962914
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38962992 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
38962914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 4203456 - 4203632
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||| ||||||| | |
|
|
T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgccta-taaaaaaaattgtttttggtctgtgcaaaatttcttgtttttg |
4203554 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||| ||||||| |
|
|
T |
4203555 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaattttgtaatttttgg |
4203632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10408928 - 10409110
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn------ttgtttttggtccctgcaaaannnnnnn |
315 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaaaaattgtttttgatccctgcaaaattttttg |
10409027 |
T |
 |
Q |
316 |
nnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
10409028 |
tttttgaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg |
10409110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 224 - 399
Target Start/End: Complemental strand, 16038738 - 16038560
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
16038639 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
16038638 |
gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
16038560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 294091 - 294013
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
294091 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
294013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38786159 - 38786336
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
38786258 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
T |
38786259 |
gaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacc-attttgtagtttttgg |
38786336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 33336027 - 33335845
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
33336027 |
tggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtcgctgcaaaattttttgt |
33335928 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
33335927 |
ttttgaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaatcaattttgtagtttttgg |
33335845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 7075860 - 7075782
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
7075860 |
gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
7075782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 25779060 - 25778982
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||| |
|
|
T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttatagtttttgg |
25778982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 31037497 - 31037575
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
31037575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 37090640 - 37090562
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttgg |
37090562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 38496521 - 38496599
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg |
38496599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 25561704 - 25561887
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt---nnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25561704 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt |
25561803 |
T |
 |
Q |
318 |
nnngaaaat-agtccctgacccca-cttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||| ||||||||| |||||||||||||||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
T |
25561804 |
tttgaaaataagtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaataaattttgtagtttttgg |
25561887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 323 - 399
Target Start/End: Complemental strand, 21125170 - 21125094
Alignment:
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
21125170 |
aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
21125094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 28863839 - 28863656
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt------tgtttttggtccctgcaaaannnnnn |
314 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
28863839 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaatttttt |
28863740 |
T |
 |
Q |
315 |
nnnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| |
|
|
T |
28863739 |
gttttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtagtttttg |
28863656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 34125307 - 34125484
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
T |
34125307 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgttttt |
34125406 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||| |||| |||| |||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
34125407 |
taaaatagtctctga-cccatttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
34125484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 39379330 - 39379408
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| || ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
39379330 |
gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
39379408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 40029141 - 40029316
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||| ||||||| ||||||||||||||| |||||| |||||||| ||||||| |||| | |
|
|
T |
40029141 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaaaaaaaaattgtttttcgtccctgtaaaattttttgtttttg |
40029240 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||| || ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40029241 |
aaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaattttgtagttttt |
40029316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 18046250 - 18046172
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||| |||| |
|
|
T |
18046250 |
gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaattttatagttcttgg |
18046172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 3850525 - 3850448
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
3850525 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
3850448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 24782274 - 24782099
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||| | |||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
24782274 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaattgtttttggtccctgcaaaattttttgttttt |
24782176 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| ||||||| || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
24782175 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttt |
24782099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 10744054 - 10743876
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
10744054 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccctacaaatttttttgttttt |
10743955 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||||| |||||||||||||||| |
|
|
T |
10743954 |
taaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtagtttttgg |
10743876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 14318300 - 14318223
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||| | ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||| |
|
|
T |
14318300 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttg |
14318223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 18633599 - 18633656
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 27916564 - 27916641
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||| ||||||||||||| || || || ||||||||||||||||||||||||| |
|
|
T |
27916564 |
aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtagtttttgg |
27916641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29172886 - 29172829
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29875725 - 29875668
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29875725 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40029498 - 40029442
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40029498 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2217494 - 2217549
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7075572 - 7075627
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28863510 - 28863565
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29692744 - 29692799
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29692744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30800494 - 30800549
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36578083 - 36578028
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 325 - 399
Target Start/End: Complemental strand, 3850719 - 3850645
Alignment:
Q |
325 |
atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| ||||||||| || |||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
3850719 |
atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
3850645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 15635707 - 15635650
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
15635707 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 29366950 - 29366770
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| | | ||||||||||||||||||| |
|
|
T |
29366950 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaattttttttatagtttttggtccctgcaaaattttttgttt |
29366851 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| |||||||| ||||| || | |||||| ||||| |||||||||| |
|
|
T |
29366850 |
tttaaaataatccctgaccccatttttgtgatgatttacatacgtgacacatgatgattgaacctattttatagtttttgg |
29366770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 6912496 - 6912552
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
6912496 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 10743724 - 10743776
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 16038377 - 16038429
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18046348 - 18046296
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18046348 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26133182 - 26133238
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
26133182 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1105148 - 1105093
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1105148 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1381611 - 1381556
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1381611 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5917460 - 5917405
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
5917460 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11799458 - 11799403
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
11799458 |
ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 13990708 - 13990783
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| |||||| | ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||| |
|
|
T |
13990708 |
aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtagttttt |
13990783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19565831 - 19565776
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
19565831 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19685380 - 19685325
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
19685380 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24443744 - 24443689
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
24443744 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26133413 - 26133358
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35928064 - 35928119
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
35928064 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 38170514 - 38170569
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38170514 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40167786 - 40167841
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40167786 |
ggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40764415 - 40764470
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
40764415 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9179920 - 9179743
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
T |
9179920 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttgtttttt |
9179821 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| | ||||||| | |||||||||||||| |||||||||||| ||||| ||||| ||||| |||||||||| |
|
|
T |
9179820 |
-aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacctattttatagtttttgg |
9179743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 10409326 - 10409269
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
T |
10409326 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggt |
10409269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 25561999 - 25561942
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggt |
25561942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29151851 - 29151794
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
T |
29151851 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 38496782 - 38496725
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 39379610 - 39379553
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt |
39379553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 45137 - 45193
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
45137 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 293828 - 293880
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13990895 - 13990843
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13990895 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 20660948 - 20661000
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
20660948 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 21050914 - 21050858
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
21050914 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35928459 - 35928403
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35928459 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1104858 - 1104913
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
1104858 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1381247 - 1381302
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
1381247 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3850599 - 3850544
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3850599 |
ggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4203770 - 4203715
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5917126 - 5917181
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
5917126 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11799129 - 11799184
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18046038 - 18046093
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19565467 - 19565522
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19565467 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19685017 - 19685072
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19685017 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20986089 - 20986034
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
20986089 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21124913 - 21124968
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
21124913 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24443380 - 24443435
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
24443380 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24781989 - 24782044
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
T |
24781989 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34125632 - 34125577
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
34125632 |
ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35876688 - 35876743
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35876688 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37271359 - 37271414
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
37271359 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40168008 - 40167953
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
40168008 |
ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40764780 - 40764725
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
40764780 |
ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 22551214 - 22551144
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| |||| || ||||||| ||||||||| |
|
|
T |
22551214 |
aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag |
22551144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 3850298 - 3850355
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgg-ttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
T |
3850298 |
tggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg |
3850355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 271
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag |
271 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 5614166 - 5614218
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14318045 - 14318097
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
T |
14318045 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18258527 - 18258475
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
18258527 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20661312 - 20661256
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
20661312 |
tggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28213373 - 28213425
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
28213373 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 31037741 - 31037693
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 31602264 - 31602320
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |||| |||||| ||||||||| |
|
|
T |
31602264 |
ccccacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag |
31602320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35609302 - 35609358
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
35609302 |
tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| || || |||||| ||||||||||||||||||||||||||||||| |
|
|
T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4736542 - 4736487
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
4736542 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9179593 - 9179648
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
9179593 |
ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12144907 - 12144962
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
12144907 |
ggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18258162 - 18258217
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
18258162 |
ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20683747 - 20683802
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
T |
20683747 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 20690733 - 20690784
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
20690733 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 23381950 - 23382005
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25779162 - 25779107
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26071291 - 26071346
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
26071291 |
ggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28871994 - 28871939
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| ||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
28871994 |
ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35877052 - 35876997
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
35877052 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
35876997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37271706 - 37271651
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
37271706 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 38962805 - 38962856
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||||||||||| ||||||| ||||||||||||||||| |
|
|
T |
38962805 |
tggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 330 - 392
Target Start/End: Original strand, 17070646 - 17070708
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||| || | |||| | ||||||||| |
|
|
T |
17070646 |
ccctgaccccacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtag |
17070708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 18286741 - 18286691
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
18286741 |
ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
20690840 |
gtccctgaccccacttttgtgatgatttgcatacatggcacat |
20690882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |||| |||||| || |||||||| |||| |
|
|
T |
26071397 |
tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
26071458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||||| | ||||||||||||||||||||||||||||||| |
|
|
T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 42994067 - 42994116
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
T |
42994067 |
tggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 2636668 - 2636720
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| ||||| ||||||||||||| | |||||||||||||||||| |
|
|
T |
2636668 |
tggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 321 - 397
Target Start/End: Original strand, 9532291 - 9532367
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
||||||||| | || ||||| ||||||||||||||||||||||| ||||| | || ||||| |||||||||||||| |
|
|
T |
9532291 |
gaaaatagttcttggccccatttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtagttttt |
9532367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40038859 - 40038803
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||| |||||||||||| |||||| |
|
|
T |
40038859 |
tggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 42553641 - 42553693
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
42553641 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3851329 - 3851274
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
T |
3851329 |
ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 4736433 - 4736374
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| |||||||||||||||| |||| ||||||||||| || |||||||| |||| |
|
|
T |
4736433 |
gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt |
4736374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5904008 - 5904063
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
T |
5904008 |
ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 5904260 - 5904205
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||| |||||||||||||||||||||||||| || || ||||||||||| |||| |
|
|
T |
5904260 |
ctgacctcacttttgtgatgatttgcatacgtgacatatgataactgaacccattt |
5904205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 279
Target Start/End: Original strand, 6118139 - 6118190
Alignment:
Q |
229 |
atatagttttagtccctgcaaatatgcctcgtttt-ggttttagtccctggt |
279 |
Q |
|
|
|||| ||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt |
6118190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10830638 - 10830697
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| |||| || |||||||| |||| |
|
|
T |
10830638 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt |
10830697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 11935861 - 11935802
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||| ||||| |||||||||||| |||||| |||| |||||| ||||||||| |
|
|
T |
11935861 |
gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaattt |
11935802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 15916285 - 15916340
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||| || ||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
15916285 |
tggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17070863 - 17070808
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| |||||||| |||||||| ||||||| ||||| |
|
|
T |
17070863 |
ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg |
17070808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| ||||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||| ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
37271597 |
gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
37271542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40038604 - 40038663
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
40038604 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt |
40038663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
20661057 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacat |
20661099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 38555083 - 38555030
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||| ||||||||||||||||| |
|
|
T |
38555083 |
ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 11799205 - 11799279
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| || ||||||||||||||| |||| ||||| |||||| ||| |||||||||||||||||||||| |
|
|
T |
11799205 |
gaaaatagtccttggccccacttttgtgataattt----acgtgacacattttaaaagaaccaattttgtagtttttgg |
11799279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 20416360 - 20416413
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||| |||||||| |||||| |
|
|
T |
20416360 |
ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| |||||||||||||||||||| ||| |||||| |||||||| |
|
|
T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc |
31037446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 222 - 267
Target Start/End: Original strand, 31602143 - 31602188
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtt |
267 |
Q |
|
|
||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
T |
31602143 |
ggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 32108926 - 32108975
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
32108926 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
32108975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 9588611 - 9588559
Alignment:
Q |
223 |
gctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| | |||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 26071597 - 26071561
Alignment:
Q |
241 |
tccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||| |
|
|
T |
26071597 |
tccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||| |||||||||||||| | ||||||||||||||||||||| |
|
|
T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 40038494 - 40038542
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
T |
40038494 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 1105075 - 1105032
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
1105032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 1286938 - 1286879
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| |||| ||||| || |||||||| |||| |
|
|
T |
1286938 |
gtccctgtccccacttttgtgatgatttgcaagcgtgacacataatgactgaacccattt |
1286879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 2636778 - 2636837
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| |||| |
|
|
T |
2636778 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt |
2636837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 5104002 - 5103951
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| || |||||||||||| ||| ||||||||||||| |
|
|
T |
5104002 |
tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 9588499 - 9588444
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||| ||||||||||||| |||| |||||||||||||| || |||||||| |||| |
|
|
T |
9588499 |
ctgactccacttttgtgataatttacatacgtggcacatgatgactgaacccattt |
9588444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10830529 - 10830584
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| || ||||||||||| |||||||||||||| |||| |
|
|
T |
10830529 |
ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17070535 - 17070589
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||| |||| |||||||||||| |
|
|
T |
17070535 |
ggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 322 - 381
Target Start/End: Original strand, 18286530 - 18286589
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||| ||| ||||| |||||||||||||| ||||||||||| || || ||||||| |
|
|
T |
18286530 |
aaaatagtctctggccccagttttgtgatgatttacatacgtggcatatgatgactgaac |
18286589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 19685125 - 19685180
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
19685125 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
19685180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 24443489 - 24443544
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
24443489 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
24443544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 338 - 381
Target Start/End: Original strand, 28107918 - 28107961
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
28107918 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
28107961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 28213446 - 28213489
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctgg |
28213489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 28213490 - 28213541
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
28213490 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
28213541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 28871711 - 28871754
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgg |
28871754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32108808 - 32108863
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||| |||||| |||||| |
|
|
T |
32108808 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 35609382 - 35609441
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
35609382 |
gtccctgtcgccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
35609441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 36973352 - 36973403
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||| ||| || |||||||| ||||||||||||||||| |
|
|
T |
36973352 |
tggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 1286974 - 1286932
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1286932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 12145181 - 12145127
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||||||||| |||| ||| |||| |
|
|
T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg |
12145127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||| |||| |||| ||||||||||| ||||||||| |||||||||| |
|
|
T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| | ||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29855614 - 29855668
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| |||| |||| || ||||||||||| |||||||||||||||||| |
|
|
T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 273
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 31602515 - 31602465
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||||||||||| | | |||||||| ||||||||| ||||||| |
|
|
T |
31602515 |
ggctaaaatatagttttagttcatacaaatatgtctcgttttgattttagt |
31602465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 387
Target Start/End: Original strand, 32888798 - 32888848
Alignment:
Q |
337 |
cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
T |
32888798 |
cccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
32888848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||||||||| ||||| |
|
|
T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 10830897 - 10830844
Alignment:
Q |
222 |
ggctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| | |||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
10830897 |
ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc |
10830844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||| |||||||| |||||||||||| || |||||||||||| |
|
|
T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| |||| || |||||||||||| |||||||||||||||||| |
|
|
T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 38496420 - 38496476
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||||||||||||| || ||||||| || ||||||||||||||| |||| |
|
|
T |
38496420 |
ggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtccttggt |
38496476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||| ||||||| ||| ||||||||||||| |||| |
|
|
T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 358
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgca |
358 |
Q |
|
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
T |
26133311 |
aaaatagtccctaaccccatttttgtgatgatttgca |
26133275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||| |||||||||||||||||| ||||||||||| ||||| |
|
|
T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtccc |
32888800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 38554751 - 38554800
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
38554751 |
ggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtc |
38554800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 99; Significance: 9e-49; HSPs: 232)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45073641 - 45073463
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgttttt |
45073542 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45073541 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
45073463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 17999721 - 17999545
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| | |
|
|
T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
17999623 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17999622 |
aaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
17999545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 7431950 - 7432131
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
7431950 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt |
7432049 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7432050 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
7432131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 44508719 - 44508898
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
44508719 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccctgcaaaaatttttgtttt |
44508818 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
44508819 |
tgaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtagtttttgg |
44508898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35015220 - 35015040
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgttt |
35015121 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35015120 |
ttgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
35015040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 1007230 - 1007051
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
T |
1007230 |
tggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
1007131 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1007130 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
1007051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 44344789 - 44344612
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg |
44344690 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
44344689 |
aaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaattttatagtttttgg |
44344612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 45021493 - 45021675
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgg-ttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| ||||||||||| |
|
|
T |
45021493 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccctgcaaaattttttgt |
45021592 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45021593 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
45021675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 37372904 - 37372726
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
37372805 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37372804 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtagtttttgg |
37372726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19783815 - 19783994
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
T |
19783815 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtccctgcaaatttttttgtttt |
19783914 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19783915 |
tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
19783994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 30352563 - 30352740
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||| || |||||| |||||||||||| | |
|
|
T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaattttttgtttttg |
30352662 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30352663 |
aaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
30352740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 39719352 - 39719533
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
39719352 |
tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaaaaagaaaattttgtttttggtccctgcaaaagattttgtt |
39719451 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39719452 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
39719533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 28911577 - 28911757
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
28911577 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
28911676 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
T |
28911677 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtagtttttgg |
28911757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 48359076 - 48358898
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| | || ||||||||| ||||||||||| |
|
|
T |
48359076 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaaaaaaaaattgtttttgatccctgcaaaattttttgttttt |
48358977 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48358976 |
taaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
48358898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 19561153 - 19561327
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
19561153 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttca----aaaaaattttgtttttggtccctgcaaaattttttgttttt |
19561248 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
19561249 |
gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
19561327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 46304385 - 46304203
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
46304385 |
tggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaaaatttgttttttgtccctgcaaaattttttgt |
46304286 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46304285 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
46304203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5308686 - 5308508
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
5308686 |
ggctaaaatat-gttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
5308588 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
5308587 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
5308508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 21554753 - 21554575
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
21554654 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
21554653 |
tgaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtagtttttg |
21554575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 6108596 - 6108518
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
6108518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 39832906 - 39833081
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||| | |
|
|
T |
39832906 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctacaaatttttttgtttttg |
39833005 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||| |
|
|
T |
39833006 |
aaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttngtagttttt |
39833081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1559705 - 1559527
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt |
1559606 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
T |
1559605 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttataatttttgg |
1559527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 12894301 - 12894223
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12894301 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
12894223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 21223508 - 21223586
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
21223586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 31732350 - 31732272
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31732350 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
31732272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 488814 - 488892
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
488814 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
488892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 390
Target Start/End: Original strand, 30709328 - 30709494
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| ||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||| ||| |
|
|
T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
30709427 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
390 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
30709428 |
aatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt |
30709494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 44403250 - 44403073
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct-ggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
44403250 |
tggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctataaaaaaaaaattgtttttggtcactgcaaaa--aattgtttt |
44403153 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
44403152 |
agaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtagtttttgg |
44403073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 18022468 - 18022545
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18022468 |
aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
18022545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 18311682 - 18311759
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
18311682 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttgg |
18311759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 225 - 398
Target Start/End: Original strand, 14738603 - 14738777
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||| |||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||| ||||||| || |
|
|
T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc-tggtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttttga |
14738701 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
14738702 |
aaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtaatttttg |
14738777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19757748 - 19757929
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg----tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttgttttgtttttggtccttgcaaattcttttgtt |
19757847 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
19757848 |
tttgaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
19757929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 10358001 - 10358181
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10358001 |
ggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaagttttgtttttggtccctgcaaaattttttgtt |
10358100 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
T |
10358101 |
ttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttg |
10358181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 13769773 - 13769950
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||| ||||||| |
|
|
T |
13769773 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccttgcaaaattttttgttttt |
13769872 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||| | ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
13769873 |
taaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg |
13769950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 221 - 386
Target Start/End: Complemental strand, 25547491 - 25547325
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
T |
25547491 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttt |
25547392 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatt |
386 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25547391 |
tgaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaatt |
25547325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35210515 - 35210333
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-----gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||| ||||||| |
|
|
T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaataaaattgtttctggtccttgcaaaattttttgt |
35210416 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
35210415 |
ttttgaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtagtttttgg |
35210333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 31310577 - 31310500
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| | |||||||||||||||| |
|
|
T |
31310577 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtagtttttgg |
31310500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 20388274 - 20388453
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt--gtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaaatctgtttttggtccctgcaaaattttttgtctt |
20388373 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||||| |||||||||||||||||||||||||| || || |||||||| |||||||||||||||| |
|
|
T |
20388374 |
ttaaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtagtttttgg |
20388453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 321 - 384
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
384 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
22871162 |
gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
22871225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 1006834 - 1006892
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1006834 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 30352905 - 30352847
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
30352847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 6108334 - 6108391
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 44509054 - 44508997
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12894402 - 12894347
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28911906 - 28911851
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 23816933 - 23816856
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||| ||||||||||||| || ||| |||| |||||||||||||||| |
|
|
T |
23816933 |
aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtagtttttgg |
23816856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 10358369 - 10358313
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10358369 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 16853590 - 16853534
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
16853590 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 335 - 399
Target Start/End: Original strand, 19465733 - 19465797
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
19465733 |
accccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
19465797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 39833237 - 39833181
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
39833237 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1559343 - 1559398
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1614904 - 1614849
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1614904 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3975549 - 3975604
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
3975549 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6509208 - 6509263
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6509470 - 6509415
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
6509470 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8144658 - 8144603
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8144658 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8555799 - 8555744
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9659689 - 9659634
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
9659689 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 23399612 - 23399667
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
23399612 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23676452 - 23676397
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
23676452 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25988749 - 25988694
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
25988749 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26878071 - 26878016
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
26878071 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29198662 - 29198607
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29198662 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45228918 - 45228863
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
45228918 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 46648516 - 46648590
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| |||||||| |||||||||||||||| |||||||||||| || |||||||| |||||||||||||| |
|
|
T |
46648516 |
aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtagttttt |
46648590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48192488 - 48192433
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
48192488 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 21223748 - 21223694
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
21223748 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 14739004 - 14738947
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1974008 - 1974064
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1974008 |
tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 1974207 - 1974147
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||| ||||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
T |
1974207 |
cactattgtgatgatttgcatacgtgacaaattataactgaaccaattttttagtttttgg |
1974147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3975838 - 3975786
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
3975838 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18022704 - 18022652
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18022704 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 27037592 - 27037648
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
27037592 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31732100 - 31732156
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
T |
31732100 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1614559 - 1614614
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
1614559 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5233808 - 5233863
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
5233808 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5354768 - 5354823
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
T |
5354768 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8144295 - 8144350
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8144295 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13770081 - 13770026
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23399976 - 23399921
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
23399976 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 23816670 - 23816721
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
23816670 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25092160 - 25092215
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25092160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25092548 - 25092493
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
25092548 |
ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25988385 - 25988440
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
25988385 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27458399 - 27458454
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
27458399 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35104078 |
ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35104295 - 35104240
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
35104295 |
ggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35665877 - 35665932
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
T |
35665877 |
ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35838337 - 35838282
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35838337 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39719642 - 39719587
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 41054236 - 41054181
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
41054236 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44402960 - 44403015
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||| | |||||||||||||||||| |
|
|
T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45073314 - 45073369
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
45073314 |
ggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 45671314 - 45671389
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||| ||||||||| || ||||||||||||||||||||||| ||||| || ||||||| |||||||||||||| |
|
|
T |
45671314 |
aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtagttttt |
45671389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 45021856 - 45021806
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
45021856 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 6589020 - 6589073
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |||| |
|
|
T |
6589020 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 21554392 - 21554445
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
21554392 |
tggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
T |
35665984 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac |
35666037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||| |||||||||||| |
|
|
T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg |
43058805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5308322 - 5308378
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
T |
5308322 |
tggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 18927092 - 18927040
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
T |
18927092 |
tggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 30223795 - 30223743
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
T |
30223795 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 35837924 - 35837976
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
35837924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46304086 - 46304138
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
46304086 |
ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 46648715 - 46648667
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
T |
46648715 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46759658 - 46759710
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
T |
46759658 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 48852444 - 48852496
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
T |
48852444 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 1271587 - 1271544
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1271587 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2945845 - 2945790
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||| ||||||||||||||||||||||||||||||| |
|
|
T |
2945845 |
ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3807864 - 3807919
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| || |||||||||||| ||||||||||||||||| |||| |
|
|
T |
3807864 |
ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5234204 - 5234149
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
T |
5234204 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 9659464 - 9659523
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
9659464 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9659523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||| |||||| |
|
|
T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11767275 - 11767220
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| || |||||||||||||||||| |
|
|
T |
11767275 |
ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12932783 - 12932728
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
12932783 |
ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16940762 - 16940817
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||| |||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
16940762 |
ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28262713 - 28262768
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
T |
28262713 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29198303 - 29198358
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30223461 - 30223516
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
T |
30223461 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 30709644 - 30709593
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
30709644 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 39438741 - 39438792
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||| |||||||||||||||||||||||||| |
|
|
T |
39438741 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39439029 - 39438974
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
T |
39439029 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41053842 - 41053897
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
T |
41053842 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 322 - 396
Target Start/End: Complemental strand, 41365112 - 41365040
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
396 |
Q |
|
|
||||||||||| |||| | |||||||||||||||||||| |||||||| || |||||||| ||||||||||||| |
|
|
T |
41365112 |
aaaatagtccc--acccaatttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtagtttt |
41365040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44568326 - 44568381
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
44568326 |
ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44568690 - 44568635
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
44568690 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 46828944 - 46828999
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
T |
46828944 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 24954049 - 24953979
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||| ||||| ||||||| |||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
T |
24954049 |
aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag |
24953979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 268
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
268 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| ||||| |||||||||||||||||| |||||||||||||||| |
|
|
T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| ||||| |||||||||||||||| ||||||||||||||||| |
|
|
T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||| ||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 271
Target Start/End: Complemental strand, 31732451 - 31732402
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag |
271 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||| |||||| |
|
|
T |
31732451 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 32189075 - 32189124
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
T |
32189075 |
tggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 35104125 - 35104186
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
T |
35104125 |
tagtccctgactccacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt |
35104186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||| |||||||| || ||||||||||||||||||||||||||| |
|
|
T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 43300730 - 43300787
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| |||||||||||||||||||||| || |||||||| ||| |||||||||||| |
|
|
T |
43300730 |
ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtagtttttgg |
43300787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||| ||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 237 - 277
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
Q |
237 |
ttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctg |
12894096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14543710 - 14543762
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
T |
14543710 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
Q |
237 |
ttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctg |
19758004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20388676 - 20388620
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
T |
20388676 |
tggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||||||||||||||||||| ||||||||| |||||||| |
|
|
T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 399
Target Start/End: Complemental strand, 32189280 - 32189216
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| ||||||||||||||||||| |||||||| || | |||||| |||||||||||||||| |
|
|
T |
32189280 |
accccatttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtagtttttgg |
32189216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 322 - 370
Target Start/End: Complemental strand, 37952950 - 37952902
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||||||||| |||||||||||||||||| |||||||||||| |||||| |
|
|
T |
37952950 |
aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacat |
37952902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||| |||||||||||| |
|
|
T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 46829313 - 46829257
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
T |
46829313 |
tggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 489072 - 489017
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||| ||||||||||| ||||||||| |||||||||||| |
|
|
T |
489072 |
ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 5355009 - 5354950
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
5355009 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5354950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9659355 - 9659410
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
T |
9659355 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19465980 - 19465926
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
T |
19465980 |
ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg |
19465926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 24717533 - 24717478
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
T |
24717533 |
tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26877678 - 26877733
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || ||||||||||| |||||||||||||||||||||| |
|
|
T |
26877678 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 31310365 - 31310416
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
31310365 |
ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35470280 - 35470225
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| | ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
T |
35470280 |
ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 35838033 - 35838092
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||| ||| |||| |
|
|
T |
35838033 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactggacccattt |
35838092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 39520398 - 39520453
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| | |||||||| |||||||||||||||||||||| |
|
|
T |
39520398 |
ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 39520507 - 39520566
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
39520507 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
39520566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41364884 - 41364939
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| || || |||||||| |||||||||||||||||||||| |
|
|
T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg |
41364939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44958506 - 44958451
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||| |||||||| |||||||||||||||||||||| |
|
|
T |
44958506 |
ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45228615 - 45228670
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| | ||| |||||||||||||||||| ||||||||||||| |
|
|
T |
45228615 |
ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46759864 - 46759805
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
46759864 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
46759805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
T |
2945736 |
gtccctggccccacttttgtgatgatttgcacacgtggcacat |
2945694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 7432249 - 7432195
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| |||||| | |||||||||||||||||||||| |||||||| ||||| |
|
|
T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggt |
7432195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 323 - 365
Target Start/End: Complemental strand, 17854356 - 17854314
Alignment:
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgg |
365 |
Q |
|
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
T |
17854356 |
aaatagtccctgactccatttttgtgatgatttgcatacgtgg |
17854314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||||||||| ||||||| ||||||| ||||||||| ||||||| |
|
|
T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| |||||| |||||||| || ||||||||||||||||||| |
|
|
T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 3975730 - 3975677
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||| |||||||||| |||||||||| ||||||||||| || ||||||| |
|
|
T |
3975730 |
gtccctgactccacttttgtaatgatttgcacacgtggcacatgatgactgaac |
3975677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 6911248 - 6911199
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||| ||||| || ||||||||||| |||||||||||||||| |
|
|
T |
6911248 |
tggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 11767036 - 11767085
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
11767036 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
11767085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 16940871 - 16940924
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
16940871 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
16940924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 30223580 - 30223629
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
30223580 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
30223629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 388
Target Start/End: Original strand, 34877885 - 34877942
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
|||||||||||||||||||||||||||| ||| ||||||| || | |||||| ||||| |
|
|
T |
34877885 |
cctgaccccacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt |
34877942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| ||||||||||||| ||||||| || |||||||||||||||||| |
|
|
T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 38186642 - 38186589
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||||||||||||| ||||| ||||| || |||||||| ||||||||| |
|
|
T |
38186642 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag |
38186589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 8555607 - 8555655
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||||||||||||| ||||||||||| || |||||||||||| |
|
|
T |
8555607 |
ggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 24953832 - 24953872
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||||||||||||| | |||||||||||||||| |
|
|
T |
24953832 |
gttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 34878125 - 34878077
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
T |
34878125 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 35469879 - 35469931
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
35469879 |
tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||||||||||| ||||||| || ||||||||||||||| |
|
|
T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 38186761 - 38186709
Alignment:
Q |
222 |
ggctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| | |||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
38186761 |
ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 387
Target Start/End: Original strand, 44841471 - 44841523
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
T |
44841471 |
accccacttttgtgatgatttggacacgtggcacatgatgactgaacccattt |
44841523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 367
Target Start/End: Original strand, 6892003 - 6892042
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggca |
367 |
Q |
|
|
||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
6892003 |
gtccctgaccccacttttgtgatgatttgcacaggtggca |
6892042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6892260 - 6892205
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||| ||| || ||||||| ||||||||||| |
|
|
T |
6892260 |
ggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
Q |
226 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22539930 - 22539985
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||| |||||||||||| ||||||||||||| |||| |
|
|
T |
22539930 |
ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23817034 - 23816979
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| ||| ||||||| ||||||||||| ||||| |||| |
|
|
T |
23817034 |
ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 27458472 - 27458515
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
27458515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 27458508 - 27458567
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
27458508 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
27458567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| || |||| ||||||| ||||||| |||||||||||||| |
|
|
T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35210182 - 35210237
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||| ||||||||| |||||||||||||||||||||| |
|
|
T |
35210182 |
ggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
Q |
340 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
35470159 |
acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35470112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 35470207 - 35470164
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctgg |
35470164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 38486790 - 38486739
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| |||||| ||||||||| |||||||||||||||| |
|
|
T |
38486790 |
ggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 41054067 - 41054008
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
T |
41054067 |
gtccctggctccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
41054008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 41054103 - 41054060
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
41054060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 45228693 - 45228752
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||| ||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
45228693 |
gtccctggctccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
45228752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 276
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| ||||||||| |||||||||| |||||||| |||||||||||| |
|
|
T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46829201 - 46829142
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| || || ||||| || | ||||||||||| |
|
|
T |
46829201 |
gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaattt |
46829142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48854070 - 48854015
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
48854070 |
ggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 273
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 370
Target Start/End: Complemental strand, 6847007 - 6846969
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
T |
6847007 |
ctgaccccacttttgtgatgatttgcgcacgtggcacat |
6846969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 243 - 277
Target Start/End: Complemental strand, 27458698 - 27458664
Alignment:
Q |
243 |
cctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |
|
|
T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctg |
27458664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 381
Target Start/End: Complemental strand, 38486673 - 38486631
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
38486673 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaac |
38486631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 387
Target Start/End: Complemental strand, 3808072 - 3808011
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||| |||||| |||||||||||||||||||| ||||| ||||| || || ||||| |||| |
|
|
T |
3808072 |
tagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatgaccgaacccattt |
3808011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 6589080 - 6589129
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
6589080 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
6589129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 18926889 - 18926942
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||| | | |||||||| ||||||||||||| |||||||| |
|
|
T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg |
18926942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||| |
|
|
T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 337 - 381
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
Q |
337 |
cccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
T |
28262960 |
cccacttttgtgatgatttgcacacgtgacacataatgactgaac |
28262916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
|||||||| ||||| ||| ||||||||||| |||||||||||||| |
|
|
T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| | ||||| ||||||| ||| |||||||||||||||||| |
|
|
T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 44344457 - 44344505
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| |||||||| || ||||||||| ||||||| ||||||| |
|
|
T |
44344457 |
ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 99; Significance: 9e-49; HSPs: 294)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 3152111 - 3151934
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
3152012 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3152011 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
3151934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 39437109 - 39436929
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
39437010 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
39437009 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
39436929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 10976977 - 10977157
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
10976977 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccctgcaaaattttttgttt |
10977076 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10977077 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtagtttttgg |
10977157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 28427608 - 28427429
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
28427509 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
28427508 |
tgaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttgg |
28427429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 37506867 - 37507046
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaattttttttgtttt |
37506966 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37506967 |
tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
37507046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 8510213 - 8510394
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8510213 |
tggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtt |
8510312 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8510313 |
tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
8510394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22155929 - 22156109
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
22155929 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
22156028 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22156029 |
ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
22156109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 39288898 - 39288720
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
39288898 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgattttggtccctgcaaaattttttgttttt |
39288799 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
39288798 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
39288720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 275444 - 275621
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||| | |
|
|
T |
275444 |
ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgcaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg |
275543 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
275544 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
275621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51834942 - 51834763
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
51834942 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaactttttgtttt |
51834843 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
T |
51834842 |
tgaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaattttgtagtttttgg |
51834763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 21159817 - 21159637
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
21159817 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt |
21159718 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21159717 |
ttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
21159637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 34238598 - 34238775
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
34238598 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt |
34238697 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34238698 |
tgaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
34238775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 26799888 - 26800067
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
26799888 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
26799987 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
T |
26799988 |
ttgaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttttagtttttg |
26800067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 20757403 - 20757578
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
20757502 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20757503 |
aatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
20757578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 40169655 - 40169474
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
T |
40169655 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaattttttgtt |
40169556 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
40169555 |
tttgaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtagtttttgg |
40169474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45320979 - 45320801
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
T |
45320979 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttgatccctgcaaaattttttgttttt |
45320880 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
45320879 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
45320801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 14633889 - 14633708
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||| ||| ||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
14633889 |
ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt |
14633790 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14633789 |
tttgaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
14633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 13584105 - 13584183
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
13584183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 19656802 - 19656724
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
19656724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 395
Target Start/End: Complemental strand, 20612898 - 20612724
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| |
|
|
T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccttgcaaatttttttgttttt |
20612799 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt |
395 |
Q |
|
|
| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
T |
20612798 |
ggaaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtagttt |
20612724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 20907454 - 20907278
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga |
322 |
Q |
|
|
|||||||| |||||| |||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| || |
|
|
T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga |
20907355 |
T |
 |
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
20907354 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
20907278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 29955300 - 29955478
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt |
29955399 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtagtttttgg |
29955478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 30004454 - 30004632
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt |
30004553 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtagtttttgg |
30004632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 3830134 - 3830308
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| ||||||| | |
|
|
T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg-taaaaaaaattgtttttggtccttgcaaaattttttgtttttg |
3830232 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||||| |
|
|
T |
3830233 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtagttttt |
3830308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 45161116 - 45161291
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa |
323 |
Q |
|
|
|||||||| |||| |||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||| ||| |
|
|
T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa |
45161215 |
T |
 |
Q |
324 |
aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
45161216 |
aatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
45161291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 4950266 - 4950188
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4950266 |
gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
4950188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 30130158 - 30130336
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
30130257 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
T |
30130258 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtagtttttgg |
30130336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 39072112 - 39072034
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39072112 |
gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
39072034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 247 - 399
Target Start/End: Complemental strand, 10778706 - 10778553
Alignment:
Q |
247 |
caaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgaccccactttt |
345 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
10778706 |
caaatatgcctcgttttggttttagtccctggtaaaaaaaaattgttattggtccctgcaaaattttttgtttttgaaaatagtccctgaccctactttt |
10778607 |
T |
 |
Q |
346 |
gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
10778606 |
gtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
10778553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 4513620 - 4513442
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
4513620 |
ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattgtttttggtccctgcaaaattttttgttttt |
4513521 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
4513520 |
taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg |
4513442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18175791 - 18175966
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtt--ggttttaatccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttta |
18175888 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18175889 |
aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
18175966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 25710871 - 25710693
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
25710871 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtc--tgcaaaattttttattt |
25710774 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25710773 |
ttgaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtagtttttgg |
25710693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 31869956 - 31869778
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
31869956 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaactttttgttttt |
31869857 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| |||| |||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
31869856 |
gaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttatagtttttgg |
31869778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 389
Target Start/End: Original strand, 29445953 - 29446124
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
29445953 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaattttttgtt |
29446052 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg |
389 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
29446053 |
ttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg |
29446124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 222 - 387
Target Start/End: Complemental strand, 5345689 - 5345522
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaatttgtttttgatccctgcaaaattttttatttt |
5345590 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5345589 |
ttaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
5345522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 221 - 398
Target Start/End: Original strand, 16123138 - 16123319
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn |
316 |
Q |
|
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||| |||| |
|
|
T |
16123138 |
tggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtacaaaaaaaaaaattgtttttgatccctgtaaaattttttgt |
16123237 |
T |
 |
Q |
317 |
nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
16123238 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttg |
16123319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9863404 - 9863224
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| |
|
|
T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatagtttttggtccttgcaaaattttttgtttt |
9863305 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccactttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| |||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
9863304 |
tgaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
9863224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 397
Target Start/End: Complemental strand, 12673904 - 12673828
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagttttt |
12673828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 7518346 - 7518268
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
7518346 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtagtttttgg |
7518268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 46186771 - 46186591
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
T |
46186771 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt |
46186672 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||| |
|
|
T |
46186671 |
ttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg |
46186591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 333 - 399
Target Start/End: Complemental strand, 49670725 - 49670659
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
49670725 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg |
49670659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51500685 - 51500507
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
51500685 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
51500586 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||| ||| ||||||||| |||||| |
|
|
T |
51500585 |
taaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtaggttttgg |
51500507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 4814898 - 4814722
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
4814898 |
ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccctataaaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
4814800 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| || ||||||||||||||||||||||||||||| || |||| ||| |||||||||||||||| |
|
|
T |
4814799 |
aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtagtttttgg |
4814722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 383
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47901901 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca |
47901963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 50261839 - 50261762
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
50261839 |
gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaattttgtagtttttgg |
50261762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 53701360 - 53701538
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| |||||| || |||||||||||||| |||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
53701360 |
tggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttt |
53701459 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||| || || |||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
T |
53701460 |
taaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttgg |
53701538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 15016645 - 15016568
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || | |||||| |||||||||||||||| |
|
|
T |
15016645 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg |
15016568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 51759819 - 51759999
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||| |||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
51759819 |
ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
51759918 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||| ||| ||||||||| |||||| |
|
|
T |
51759919 |
tttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtaggttttgg |
51759999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 51834608 - 51834665
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 223 - 279
Target Start/End: Complemental strand, 22156292 - 22156236
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 330 - 398
Target Start/End: Complemental strand, 30426175 - 30426107
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
||||||||||| ||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
T |
30426175 |
ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtagtttttg |
30426107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4513263 - 4513318
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4513263 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4950037 - 4950092
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12673644 - 12673699
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37507222 - 37507167
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 3151750 - 3151804
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3151750 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 45521650 - 45521728
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
45521650 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttgg |
45521728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 13584367 - 13584310
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 15286402 - 15286325
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| |||||||||||||||| |
|
|
T |
15286402 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttgg |
15286325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 28942905 - 28942848
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
28942905 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 30552246 - 30552323
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||| ||||||| | |||| |||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
30552246 |
aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
30552323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 39436718 - 39436775
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3830516 - 3830464
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15016387 - 15016443
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
15016387 |
tggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 22008891 - 22008835
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
22008891 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 322 - 398
Target Start/End: Original strand, 30268585 - 30268661
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||| |||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| ||||||||| |
|
|
T |
30268585 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttatagtttttg |
30268661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 49323781 - 49323837
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
49323781 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 323 - 399
Target Start/End: Original strand, 50196401 - 50196477
Alignment:
Q |
323 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||| | ||||||||||||||||||||||||||||| || ||||||| ||| |||||||||||| |
|
|
T |
50196401 |
aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtagtttttgg |
50196477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 7957118 - 7957059
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
T |
7957118 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
7957059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 14633547 - 14633602
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggt |
14633602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22008526 - 22008581
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22016044 - 22016099
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25615975 - 25616030
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
25615975 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28552383 - 28552328
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
28552383 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30268505 - 30268560
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30268505 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31480136 - 31480191
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
31480136 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 339 - 398
Target Start/End: Original strand, 40979479 - 40979538
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
T |
40979479 |
cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgtaatttttg |
40979538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51550082 - 51550137
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
51550082 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 54608518 - 54608573
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
54608518 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 369
Target Start/End: Original strand, 28942525 - 28942674
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt--nnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccctgcaaaattttatgtttt |
28942624 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca |
369 |
Q |
|
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
T |
28942625 |
ttaaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca |
28942674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 9262155 - 9262102
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
9262155 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 10977341 - 10977284
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10977341 |
ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 20611020 - 20611077
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggt |
20611077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 28427245 - 28427302
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
T |
28427245 |
ggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 39288573 - 39288630
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt |
39288630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 43440614 - 43440671
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
43440614 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
43440671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 223 - 279
Target Start/End: Complemental strand, 3361817 - 3361761
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
3361761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 4034716 - 4034772
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
4034716 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 9261788 - 9261844
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
9261788 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15979337 - 15979393
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
15979337 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26089729 - 26089785
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
26089729 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 26090079 - 26090023
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26090079 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31480501 - 31480445
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| | ||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
31480501 |
tggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 44802281 - 44802337
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| |
|
|
T |
44802281 |
tggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 392
Target Start/End: Complemental strand, 45313864 - 45313690
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||| |
|
|
T |
45313864 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattttgat |
45313765 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
| |||||||||||| ||||||||||||||||||||| ||| ||||| ||| || |||||||| ||||||||| |
|
|
T |
45313764 |
tttggaaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag |
45313690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46751271 - 46751323
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
46751271 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 47902146 - 47902090
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
T |
47902146 |
tggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg |
47902090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 474044 - 474099
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
474044 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1721452 - 1721397
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1721452 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 7588318 - 7588369
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12740907 - 12740962
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12740907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12741271 - 12741216
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12741271 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19844581 - 19844526
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
T |
19844581 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28552021 - 28552076
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
28552021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29678024 - 29678079
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
29678024 |
ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29955666 - 29955611
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
29955666 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30004821 - 30004766
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
30004821 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30106220 - 30106165
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
30106220 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
30552478 |
ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32119220 - 32119275
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32119584 - 32119529
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
32119584 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40277931 - 40277990
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
40277931 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40277990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43441603 - 43441548
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
43441603 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45002021 - 45002076
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
T |
45002021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45002385 - 45002330
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
45002385 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47336228 - 47336283
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
47336228 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47336581 - 47336526
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
47336581 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48924240 - 48924185
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
T |
48924240 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 49670804 - 49670745
Alignment:
Q |
221 |
tggctaaaatatagttttagtccc-tgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
T |
49670804 |
tggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 50196657 - 50196602
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
T |
50196657 |
ggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 51550446 - 51550391
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
51550446 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 54608863 - 54608808
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
54608863 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 9603629 - 9603683
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
9603629 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 14772211 - 14772264
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
14772211 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 34238915 - 34238858
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||| |||||||||| |||||||||||||||||| |||| |
|
|
T |
34238915 |
ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt |
34238858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 40169344 - 40169401
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
T |
40169344 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3387604 - 3387552
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
3387604 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4035054 - 4034998
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
T |
4035054 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 4814540 - 4814588
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 7518090 - 7518142
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| || ||||||||||||||||||||||||||| |||||||||| |
|
|
T |
7518090 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7957227 - 7957171
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7957227 |
tggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 19656541 - 19656593
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
T |
19656541 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20644504 - 20644560
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
T |
20644504 |
tggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 21159453 - 21159505
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 29446206 - 29446154
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || |||||||||||||||| |
|
|
T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 29525105 - 29525157
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||| |||||||||| |
|
|
T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 39072214 - 39072158
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||||||| |||||||||||||||||||||| ||||| |||||| |
|
|
T |
39072214 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg |
39072158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 43441269 - 43441325
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
43441269 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 47005519 - 47005467
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
T |
47005519 |
ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 223 - 271
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag |
271 |
Q |
|
|
|||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 52342583 - 52342531
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
52342583 |
ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 474408 - 474353
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
474408 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4034826 - 4034885
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
4034826 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4034885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 228 - 279
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
Q |
228 |
aatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 9262045 - 9261986
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
9262045 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9261986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9597095 - 9597040
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
9597095 |
ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 15286156 - 15286207
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
15286156 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15979701 - 15979646
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
T |
15979701 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21553889 - 21553944
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
21553889 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg |
21553944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||| ||||||||| |
|
|
T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25710510 - 25710565
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
25710510 |
ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28452376 - 28452321
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
T |
28452376 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 29490743 - 29490692
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
29490743 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35565508 - 35565563
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
T |
35565508 |
ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40545564 - 40545619
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
40545564 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40979710 - 40979655
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
T |
40979710 |
ggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47005154 - 47005209
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
47005154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 30426227 - 30426174
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||||||| |||||||||| |||||||||||||||||||| |||||||||| |
|
|
T |
30426227 |
tggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
36673072 |
gtccctgaccccacttttgtgatgatttacatacgtggcacat |
36673114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 43440495 - 43440549
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| |||||||||| |||||||||| |||||||| |||||||||||| |
|
|
T |
43440495 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 322 - 396
Target Start/End: Original strand, 46901203 - 46901276
Alignment:
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt |
396 |
Q |
|
|
|||| ||||||||||| || |||| |||||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
T |
46901203 |
aaaaaagtccctgacctcattttt-tgatgatttgcatacgtgacacatgataactgaactcattttgtagtttt |
46901276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 30034353 - 30034304
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
T |
30034353 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
30034304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||| | |||||||||||| |||||||||||||||||||||| |
|
|
T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 9603919 - 9603871
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
T |
9603919 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 19844264 - 19844320
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
T |
19844264 |
tggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 30130504 - 30130452
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||| |||||| ||||||||| ||||||||||||||| ||||||||||||||| |
|
|
T |
30130504 |
ggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 50261937 - 50261885
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
T |
50261937 |
tggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 52342195 - 52342243
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
T |
52342195 |
ggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||| |
|
|
T |
52342473 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
52342421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 275834 - 275783
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
T |
275834 |
tggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 387
Target Start/End: Complemental strand, 2486785 - 2486734
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
2486785 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2486734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 8555199 - 8555140
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| |||| | ||||||||||||| |
|
|
T |
8555199 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacacgacgactgaaccaattt |
8555140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 9596986 - 9596927
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||| ||||||||||||||||||||||| || |||||||| |||| |
|
|
T |
9596986 |
gtccctgtctccacttttgagatgatttgcatacgtggcacatgatgactgaacccattt |
9596927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 20405110 - 20405055
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||| ||||||||||||||||||||||||||| ||||| || |||||||| |||| |
|
|
T |
20405110 |
ctgactccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
20405055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 27681682 - 27681627
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||| | ||| ||||||||||||||||||||||||||| |||||| |
|
|
T |
27681682 |
ggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc |
29686819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30034472 - 30034417
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
T |
30034472 |
ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30128284 - 30128339
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||| ||| ||||||||||||||||| |||| |
|
|
T |
30128284 |
ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || ||||| ||||||||| |
|
|
T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 331 - 382
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
T |
36732750 |
cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc |
36732801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40277822 - 40277877
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| | ||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
T |
40277822 |
ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
T |
46622129 |
ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 47114487 - 47114538
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
47114487 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 51500398 - 51500449
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||| ||||| ||| |||||||||||||||||||||||||| |
|
|
T |
51500398 |
ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 53113496 - 53113551
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
T |
53113496 |
ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacctattt |
53113551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||| ||||| |||||||||||||||| |||||||||||||| |
|
|
T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttg |
264 |
Q |
|
|
||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
T |
25353199 |
ggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
35177255 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 335 - 381
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
Q |
335 |
accccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
T |
35533393 |
accccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
35533439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 46901104 - 46901154
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
T |
46901104 |
ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
|||||||| ||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacat |
370 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||| |
|
|
T |
50009029 |
gtccatgaccccacttttgtgatgatttgcacacgtggcacat |
50009071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| ||||| |||| ||||||||||| |||||||||||||||||| |
|
|
T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
T |
9603738 |
gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac |
9603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||| | ||||||||| |||| |||||||||||||||||| |
|
|
T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg |
14772470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||| |||||||||| || |||||||| ||||||||||||||||| |
|
|
T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 387
Target Start/End: Complemental strand, 16679857 - 16679796
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||| || ||||||||||||||||| |||||||||| || |||||||| |||| |
|
|
T |
16679857 |
tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt |
16679796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 380
Target Start/End: Original strand, 28418653 - 28418702
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
380 |
Q |
|
|
|||| ||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
T |
28418653 |
cctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
28418702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 35177374 - 35177423
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
35177374 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35177423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 35565627 - 35565676
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
35565627 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35565676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||| ||||| ||||||||||||||| ||| ||||||||||||| |
|
|
T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| || |||||||||| ||||||||||||||||||||||| |
|
|
T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13514577 - 13514525
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||| || |||||||||||| ||||||||||||||||||| |
|
|
T |
13514577 |
ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 390
Target Start/End: Original strand, 14772323 - 14772383
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt |
390 |
Q |
|
|
|||| |||||||||||||||||||||| | ||||||||||| || | |||||| ||||||| |
|
|
T |
14772323 |
cccttaccccacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt |
14772383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28452147 - 28452199
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||| |||||||||| || |||||||||||||||| |
|
|
T |
28452147 |
ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 331 - 387
Target Start/End: Original strand, 35407551 - 35407607
Alignment:
Q |
331 |
cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||||||||||||||||||||| | | ||||||||| || |||||||| |||| |
|
|
T |
35407551 |
cctgaccccacttttgtgatgatttgtacaggtggcacatgatgactgaacccattt |
35407607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 38232241 - 38232293
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
T |
38232241 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40370284 - 40370340
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
T |
40370284 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| |||||||||| ||||||||| ||||| ||||||||||||| |
|
|
T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 243 - 274
Target Start/End: Original strand, 590197 - 590228
Alignment:
Q |
243 |
cctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
590197 |
cctgcaaatatgcctcgttttggttttagtcc |
590228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 1721196 - 1721255
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| | ||||||||| || | |||||| |||| |
|
|
T |
1721196 |
gtccctggccccacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt |
1721255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 3387338 - 3387381
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
3387381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 272
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 12741016 - 12741071
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
12741016 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
12741071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20405223 - 20405168
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| | | ||||| ||||||||||||| |
|
|
T |
20405223 |
ggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 20644614 - 20644673
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| ||||||||||||||||||||||| | ||||||||| || | |||||| |||| |
|
|
T |
20644614 |
gtccctggccccacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt |
20644673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20644876 - 20644821
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||| |||||| || ||||||| |||||||||||| |
|
|
T |
20644876 |
ggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 20757775 - 20757724
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||| ||||| |||||| |||||||| ||||||||||||||||| |
|
|
T |
20757775 |
ggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc |
20757724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 22008781 - 22008726
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
22008781 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
22008726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 22016299 - 22016244
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
22016299 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
22016244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25609767 - 25609822
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| | |||||| |||||||||||||||||||||||| |
|
|
T |
25609767 |
ggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg |
25609822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 25610022 - 25609963
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| |||||||| |||||||||| | ||||||||||| || |||||||| |||| |
|
|
T |
25610022 |
gtccctgactccacttttctgatgatttgaacacgtggcacatgatgactgaacccattt |
25609963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 25610059 - 25610016
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
25610059 |
gttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 29678388 - 29678333
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| |||| ||||||||||||||||| ||||||||||||| |||| |
|
|
T |
29678388 |
tggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29686544 - 29686599
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||| ||||| ||||| |||| |||||||||| || ||||||||||||||||||| |
|
|
T |
29686544 |
ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35407790 - 35407735
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| || ||||| ||||||||||||| |
|
|
T |
35407790 |
ggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35498416 - 35498471
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| | |||||||||| |||||||| |||||||||||||| |||||| |
|
|
T |
35498416 |
ggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 35565581 - 35565624
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtctctgg |
35565624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 39132834 - 39132791
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgg |
39132791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 45002130 - 45002185
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
45002130 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
45002185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 45005959 - 45006002
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
45006002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 45005995 - 45006054
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
45005995 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
45006054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 47114701 - 47114646
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||| |||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
T |
47114701 |
ctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
47114646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 50009284 - 50009229
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||| ||| ||||| |||| |||||||||||||||||||| ||||| |||||| |
|
|
T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg |
50009229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 52956382 - 52956433
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||||| |||| |||||| | |||||| ||||||||||||||||| |
|
|
T |
52956382 |
tggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 52956627 - 52956584
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgg |
52956584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt |
269 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||||||||| |||| |
|
|
T |
53113443 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| |||| ||| ||||||| |||||||||||||||||||||| |
|
|
T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 16123489 - 16123452
Alignment:
Q |
234 |
gttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
T |
16123489 |
gttttagtcc-tgcaaatatgcctcgttttggttttagt |
16123452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 260
Target Start/End: Complemental strand, 26273824 - 26273786
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgt |
260 |
Q |
|
|
||||||||||| ||||||||||| ||||||||||||||| |
|
|
T |
26273824 |
ggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| | |||||| |||||||||||| |
|
|
T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||| ||||| |||| || ||||||||||||||||||||||| |
|
|
T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 31480391 - 31480337
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||| |
|
|
T |
31480391 |
gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacc |
31480337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 387
Target Start/End: Complemental strand, 38232498 - 38232440
Alignment:
Q |
329 |
tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| |||||||||||||||||| | ||||| ||||| || |||||||| |||| |
|
|
T |
38232498 |
tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt |
38232440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 39071862 - 39071912
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||||| ||||||||| | ||||||||| ||||||| |||||||| |
|
|
T |
39071862 |
ggctaaaatatatttttagtccttacaaatatgcttcgttttagttttagt |
39071912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 49670477 - 49670531
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||| ||||||||| |||||||||| || |||||||||||| |||||||| |
|
|
T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggt |
49670531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 54767284 - 54767334
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
T |
54767284 |
ctgaccccacttttgtgatgatttgctcacgtgacacatgatgactgaacc |
54767334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 383
Target Start/End: Complemental strand, 8940406 - 8940361
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
8940406 |
ccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
8940361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 11463362 - 11463313
Alignment:
Q |
338 |
ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
|||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
11463362 |
ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt |
11463313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 19297947 - 19297898
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
||||||||||||||| |||| || ||||||| ||||||||| |||||||| |
|
|
T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc |
19297898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 20644584 - 20644621
Alignment:
Q |
241 |
tccctgcaaatatgcctcgttttggttttagtccctgg |
278 |
Q |
|
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
T |
20644584 |
tccctgcaaatatgtctcgttttggttttggtccctgg |
20644621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||| |||||||||||||||||||| | || ||||| ||||||||| |
|
|
T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 336 - 369
Target Start/End: Complemental strand, 29678270 - 29678237
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcaca |
369 |
Q |
|
|
||||||||||||||||||||||| |||||||||| |
|
|
T |
29678270 |
ccccacttttgtgatgatttgcacacgtggcaca |
29678237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 33794788 - 33794751
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||| |
|
|
T |
33794788 |
gtccctgcaaatatgcctcgttttaattttagtccctg |
33794751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 35936780 - 35936833
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc |
275 |
Q |
|
|
||||||||||| ||||| |||||| ||||||| | |||||||||||||| |||| |
|
|
T |
35936780 |
ggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| || ||||||||||||| |
|
|
T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 39132798 - 39132745
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||| | ||| || ||||||| |
|
|
T |
39132798 |
gtccctggccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac |
39132745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
Q |
342 |
ttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
40370465 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40370420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 40560492 - 40560529
Alignment:
Q |
240 |
gtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||| |
|
|
T |
40560492 |
gtccctgcaaatatgcctcgttttaattttagtccctg |
40560529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #286
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatg |
254 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |
|
|
T |
26800169 |
ggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #287
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 364
Target Start/End: Original strand, 27681426 - 27681462
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtg |
364 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||||| |
|
|
T |
27681426 |
gtccctgatcccacttttgtgatgatttgcacacgtg |
27681462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #288
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 36672966 - 36673014
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||| ||||||||||| || ||||||||||||||| |
|
|
T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #289
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||| |||||||||| |||||||||||||||| |||| |
|
|
T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #290
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 383
Target Start/End: Complemental strand, 49324026 - 49323982
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
|||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
T |
49324026 |
cacttttgtgataatttgcacacgtggcacatgatgactgaacca |
49323982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #291
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 51058593 - 51058645
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||||||| |||| ||||||| |||||||| ||||||||||| |
|
|
T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctg |
51058645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #292
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 381
Target Start/End: Original strand, 51058703 - 51058751
Alignment:
Q |
333 |
tgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
|||| ||||||||||||||||||||||| ||| ||||| || ||||||| |
|
|
T |
51058703 |
tgactccacttttgtgatgatttgcatatgtgacacatgatgactgaac |
51058751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #293
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 392
Target Start/End: Complemental strand, 53719214 - 53719154
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||| |||||||||||||||||||| ||||| |||| || |||||| | ||||||||| |
|
|
T |
53719214 |
ctgacctcacttttgtgatgatttgcacacgtgatacatgatgactgaatccattttgtag |
53719154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #294
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 54767524 - 54767472
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctg |
54767472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8547 - 8727
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
8547 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt |
8646 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8647 |
ttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
8727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1644 - 1464
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1644 |
ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt |
1545 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1544 |
ttgaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg |
1464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 1311 - 1368
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
1311 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 12182 - 12362
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgttt |
12281 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12282 |
ttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttgg |
12362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 12537 - 12484
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12537 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5708 - 5527
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn |
317 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
5708 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgtt |
5609 |
T |
 |
Q |
318 |
nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5608 |
tttgaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
5527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 5399 - 5456
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt |
5456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14697 - 14875
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||| |||| |
|
|
T |
14697 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgttttggtccctgtaaaattttttgttttt |
14796 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14797 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
14875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15012 - 14957
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
15012 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 9028 - 8850
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaattttttgttt |
8929 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
398 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8928 |
ttgaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg |
8850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 8734 - 8787
Alignment:
Q |
224 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 366273 - 366097
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttt |
366175 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
366174 |
aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtagtttttgg |
366097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 365979 - 366034
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 392
Target Start/End: Original strand, 5209 - 5382
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt |
5308 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5309 |
ttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 392
Target Start/End: Original strand, 5229 - 5402
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt |
5328 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5329 |
ttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
5402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 4313 - 4134
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn |
319 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||| |||||||||||| |
|
|
T |
4313 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaatttgtttttcgtccctgcaaaattttttgtttt |
4214 |
T |
 |
Q |
320 |
ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4213 |
taaaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttgg |
4134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 277
Target Start/End: Original strand, 4016 - 4064
Alignment:
Q |
229 |
atatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10168 - 10335
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||| | |
|
|
T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct--gtaa--------gtttttggtccctgcaaaattttttgtttttg |
10257 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
10258 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg |
10335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10515 - 10460
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
10515 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 3291 - 3113
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
||||||||||| |||||| |||||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||| |
|
|
T |
3291 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtacctgcaaaattttttgttttt |
3192 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
3191 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtagtttttgg |
3113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17942 - 17864
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
17942 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtagtttttgg |
17864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18043 - 17988
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
T |
18043 |
ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 2778 - 2955
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttc |
2877 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||| |||||||||||| || |||| ||| | |||||||||||||| |
|
|
T |
2878 |
aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtagtttttgg |
2955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 321 - 388
Target Start/End: Complemental strand, 35170 - 35103
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
388 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35170 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 34930 - 34988
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34930 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 63; Significance: 3e-27; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 94057 - 94237
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn |
318 |
Q |
|
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
T |
94057 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaatttttttgttt |
94156 |
T |
 |
Q |
319 |
nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
T |
94157 |
tttaaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg |
94237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
Q |
223 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 3918 - 3741
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng |
321 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaacttttttttgtttttggtccttgcaaaattttttgtttttt |
3819 |
T |
 |
Q |
322 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||| | || |||||| |||||||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
3818 |
aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtagtttttgg |
3741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 3531 - 3584
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
3531 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 24657 - 24482
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn |
320 |
Q |
|
|
|||||||||||| ||||||||| | |||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
24657 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaattgtttttggtccctgcaaaattttttgttttt |
24559 |
T |
 |
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt |
397 |
Q |
|
|
|||||||||| ||||||| || ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
T |
24558 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttt |
24482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24372 - 24427
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
T |
24372 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 55; Significance: 2e-22; HSPs: 3)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 8432 - 8510
Alignment:
Q |
321 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||| || |||||||| |||||||| ||||||| |
|
|
T |
8432 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttgg |
8510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 8330 - 8382
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
8330 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 8642 - 8590
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
8642 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 48; Significance: 3e-18; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 54815 - 54870
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
54815 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 49969 - 49914
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||| ||||||||||||| ||||||| |||||||||| || ||||||||| |
|
|
T |
49969 |
gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca |
49914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 55070 - 55015
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
383 |
Q |
|
|
||||||||| ||||||||||||| ||||||| |||||||||| || ||||||||| |
|
|
T |
55070 |
gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca |
55015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 82706 - 82651
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
82706 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 82341 - 82396
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
T |
82341 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 82450 - 82509
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||| | ||||||||||||||||||||| ||||||||||| || ||| ||||||||| |
|
|
T |
82450 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt |
82509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 75764 - 75709
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
75764 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 75359 - 75414
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
75359 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12524 - 12577
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
12524 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 46; Significance: 4e-17; HSPs: 6)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 4041 - 4098
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
4041 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
4098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 19223 - 19280
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
19223 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
19280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 4288 - 4231
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
4288 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
4231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19470 - 19413
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
279 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
19470 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
19413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 4128 - 4175
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggcacattataact |
377 |
Q |
|
|
|||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
4128 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
4175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 19310 - 19357
Alignment:
Q |
330 |
ccctgaccccacttttgtgatgatttgcatacgtggcacattataact |
377 |
Q |
|
|
|||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
19310 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
19357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 17967 - 17911
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
T |
17967 |
tggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 17863 - 17791
Alignment:
Q |
322 |
aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag |
392 |
Q |
|
|
||||||||||||||||||||| | ||||||||||||||||||||| |||| | ||||||| ||||||||| |
|
|
T |
17863 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag |
17791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 3456 - 3405
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
3456 |
tggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 27364 - 27309
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
27364 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 27072 - 27114
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 44; Significance: 6e-16; HSPs: 5)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47925 - 47980
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
47925 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
Q |
225 |
taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 358
Target Start/End: Original strand, 47972 - 48004
Alignment:
Q |
326 |
tagtccctgaccccacttttgtgatgatttgca |
358 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
47972 |
tagtccctgaccccacttttgtgatgatttgca |
48004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 223172 - 223120
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| ||| |||||||||||||| |
|
|
T |
223172 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 222884 - 222925
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 339 - 382
Target Start/End: Original strand, 148007 - 148050
Alignment:
Q |
339 |
cacttttgtgatgatttgcatacgtggcacattataactgaacc |
382 |
Q |
|
|
|||||||||||||||||||| ||||||||||| || |||||||| |
|
|
T |
148007 |
cacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
148050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 2660 - 2606
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
T |
2660 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 2412 - 2463
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
T |
2412 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 2334 - 2382
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||| ||||| ||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
2334 |
ggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 22055 - 22003
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
274 |
Q |
|
|
||||||||||| ||||| |||||| ||||| |||||||||||||||||||||| |
|
|
T |
22055 |
ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 21807 - 21858
Alignment:
Q |
336 |
ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||||||||||||||||| ||||||||| | || | ||||||||||| |
|
|
T |
21807 |
ccccacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt |
21858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 21763 - 21804
Alignment:
Q |
235 |
ttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 16723 - 16779
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
16723 |
tggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16832 - 16891
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
387 |
Q |
|
|
||||||||| ||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
T |
16832 |
gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt |
16891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 189678 - 189630
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
T |
189678 |
ggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 189329 - 189379
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
272 |
Q |
|
|
||||||||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
T |
189329 |
ggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 367
Target Start/End: Original strand, 189437 - 189476
Alignment:
Q |
328 |
gtccctgaccccacttttgtgatgatttgcatacgtggca |
367 |
Q |
|
|
||||||| ||||||||||||||||||||||| |||||||| |
|
|
T |
189437 |
gtccctggccccacttttgtgatgatttgcacacgtggca |
189476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3752 - 3807
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| |||||||||||||||| | |||||||||||| |||||| |
|
|
T |
3752 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 4079 - 4028
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
273 |
Q |
|
|
|||||||||| ||||| ||||||||||||||| |||||||| ||||||||| |
|
|
T |
4079 |
ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 36; Significance: 0.00000000004; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 2884 - 2829
Alignment:
Q |
221 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
|||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2501 - 2555
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct |
276 |
Q |
|
|
||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
T |
2501 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 2615 - 2664
Alignment:
Q |
332 |
ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
381 |
Q |
|
|
||||||||||||||||||| ||||||| ||||||||||| || ||||||| |
|
|
T |
2615 |
ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac |
2664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35084 - 35029
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
277 |
Q |
|
|
||||||||||| ||||| ||| | |||||||| |||||||||||||||||||||| |
|
|
T |
35084 |
ggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
Q |
222 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
270 |
Q |
|
|
||||||||||| | ||| |||||||||||||||| || ||||||||||| |
|
|
T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3085 times since January 2019
Visitors: 4027