View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0626_low_14 (Length: 399)

Name: NF0626_low_14
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0626_low_14
NF0626_low_14
[»] chr2 (221 HSPs)
chr2 (222-399)||(38980074-38980253)
chr2 (222-399)||(38731829-38732006)
chr2 (222-399)||(37271923-37272102)
chr2 (222-399)||(26814049-26814229)
chr2 (222-399)||(19183782-19183962)
chr2 (222-399)||(23989838-23990015)
chr2 (222-399)||(33732862-33733038)
chr2 (222-399)||(43789012-43789192)
chr2 (223-399)||(3838084-3838263)
chr2 (222-398)||(7814561-7814737)
chr2 (222-398)||(17541598-17541776)
chr2 (222-399)||(40301975-40302155)
chr2 (224-399)||(44985623-44985800)
chr2 (222-399)||(20658061-20658238)
chr2 (223-399)||(24483401-24483577)
chr2 (225-399)||(43710384-43710558)
chr2 (222-399)||(44073627-44073807)
chr2 (222-399)||(26707873-26708050)
chr2 (221-388)||(5790730-5790900)
chr2 (240-399)||(22881791-22881950)
chr2 (222-399)||(11713665-11713845)
chr2 (321-399)||(24483632-24483710)
chr2 (222-399)||(43597322-43597499)
chr2 (222-399)||(8046329-8046508)
chr2 (225-399)||(26238816-26238991)
chr2 (221-399)||(41693823-41694004)
chr2 (321-399)||(16899996-16900074)
chr2 (321-399)||(16993387-16993465)
chr2 (224-399)||(41791020-41791197)
chr2 (321-398)||(7814428-7814505)
chr2 (225-397)||(17912452-17912627)
chr2 (222-399)||(10664984-10665162)
chr2 (321-399)||(14392951-14393029)
chr2 (222-399)||(31225715-31225894)
chr2 (321-399)||(40786561-40786639)
chr2 (224-399)||(1497765-1497943)
chr2 (221-388)||(12835324-12835494)
chr2 (225-399)||(25954247-25954423)
chr2 (221-399)||(10374898-10375070)
chr2 (222-399)||(29865333-29865511)
chr2 (222-399)||(43592046-43592224)
chr2 (322-399)||(45442415-45442492)
chr2 (222-399)||(31326073-31326252)
chr2 (321-399)||(32691413-32691491)
chr2 (222-279)||(16900149-16900206)
chr2 (222-279)||(16993540-16993597)
chr2 (222-279)||(19184094-19184151)
chr2 (222-279)||(37271739-37271796)
chr2 (222-277)||(24483836-24483891)
chr2 (221-279)||(5790557-5790615)
chr2 (321-399)||(19831616-19831694)
chr2 (221-279)||(26813865-26813923)
chr2 (222-279)||(7814246-7814303)
chr2 (222-279)||(17541382-17541439)
chr2 (222-399)||(36622250-36622425)
chr2 (222-279)||(43788858-43788915)
chr2 (221-277)||(3671137-3671193)
chr2 (221-277)||(5334750-5334806)
chr2 (221-277)||(5334985-5335041)
chr2 (221-277)||(8046593-8046649)
chr2 (221-277)||(11713484-11713540)
chr2 (221-277)||(20131626-20131682)
chr2 (222-274)||(22881613-22881665)
chr2 (225-277)||(42358702-42358754)
chr2 (222-277)||(2481502-2481557)
chr2 (222-277)||(3837933-3837988)
chr2 (222-277)||(4423895-4423950)
chr2 (222-277)||(9195151-9195206)
chr2 (222-277)||(11788361-11788416)
chr2 (222-277)||(14003687-14003742)
chr2 (222-277)||(15842768-15842823)
chr2 (222-277)||(16522991-16523046)
chr2 (222-277)||(16523270-16523325)
chr2 (222-277)||(24358616-24358671)
chr2 (222-277)||(25705394-25705449)
chr2 (222-277)||(29859817-29859872)
chr2 (221-276)||(33733187-33733242)
chr2 (222-277)||(40302284-40302339)
chr2 (222-277)||(43597154-43597209)
chr2 (223-277)||(10374775-10374829)
chr2 (222-276)||(27311015-27311069)
chr2 (223-277)||(29865222-29865276)
chr2 (224-277)||(146328-146381)
chr2 (222-279)||(38639412-38639469)
chr2 (221-277)||(1497609-1497665)
chr2 (221-277)||(9195053-9195109)
chr2 (222-274)||(10671889-10671941)
chr2 (225-277)||(15842464-15842516)
chr2 (225-277)||(29859490-29859542)
chr2 (221-277)||(34317797-34317853)
chr2 (222-277)||(3671003-3671058)
chr2 (222-277)||(4424130-4424185)
chr2 (222-277)||(10665239-10665294)
chr2 (222-277)||(13215060-13215115)
chr2 (222-277)||(14003409-14003464)
chr2 (222-277)||(16673716-16673771)
chr2 (222-277)||(18113089-18113144)
chr2 (222-277)||(20131317-20131372)
chr2 (222-277)||(24358890-24358945)
chr2 (222-277)||(25705085-25705140)
chr2 (222-277)||(26239105-26239160)
chr2 (221-276)||(27109072-27109127)
chr2 (222-277)||(27310876-27310930)
chr2 (222-277)||(30215422-30215477)
chr2 (222-277)||(31226022-31226077)
chr2 (222-277)||(33576062-33576117)
chr2 (222-277)||(41451837-41451892)
chr2 (222-277)||(41693674-41693729)
chr2 (221-276)||(42695867-42695922)
chr2 (222-277)||(44559062-44559117)
chr2 (222-277)||(44985929-44985984)
chr2 (225-279)||(17912754-17912808)
chr2 (223-277)||(20939270-20939324)
chr2 (224-277)||(1137983-1138036)
chr2 (221-277)||(146635-146691)
chr2 (222-274)||(4042610-4042662)
chr2 (225-277)||(16968555-16968607)
chr2 (221-277)||(31325919-31325975)
chr2 (224-272)||(36622534-36622582)
chr2 (221-277)||(36806841-36806897)
chr2 (221-277)||(40124965-40125021)
chr2 (221-273)||(41791261-41791313)
chr2 (322-398)||(44993881-44993957)
chr2 (222-277)||(2265342-2265397)
chr2 (222-277)||(4794130-4794185)
chr2 (222-277)||(10671630-10671685)
chr2 (222-277)||(16673411-16673466)
chr2 (222-277)||(17302088-17302143)
chr2 (328-387)||(20939157-20939216)
chr2 (328-387)||(23732161-23732220)
chr2 (222-273)||(31644841-31644892)
chr2 (222-277)||(32476095-32476150)
chr2 (222-277)||(32691313-32691368)
chr2 (222-277)||(33575752-33575807)
chr2 (222-277)||(37911065-37911120)
chr2 (221-279)||(38979888-38979947)
chr2 (222-277)||(40786460-40786515)
chr2 (223-274)||(42696151-42696202)
chr2 (222-277)||(43710653-43710708)
chr2 (228-274)||(35155298-35155344)
chr2 (328-381)||(1138091-1138144)
chr2 (221-274)||(4042838-4042891)
chr2 (328-381)||(25750804-25750857)
chr2 (221-274)||(34318031-34318084)
chr2 (224-273)||(44559358-44559407)
chr2 (222-274)||(3172020-3172072)
chr2 (222-274)||(3172480-3172532)
chr2 (221-277)||(18113399-18113455)
chr2 (225-273)||(23990145-23990193)
chr2 (222-274)||(25954115-25954167)
chr2 (221-277)||(34964104-34964160)
chr2 (222-274)||(45442644-45442696)
chr2 (222-277)||(1138304-1138359)
chr2 (222-277)||(2481193-2481248)
chr2 (328-387)||(4424004-4424063)
chr2 (328-387)||(4842940-4842999)
chr2 (222-277)||(13850522-13850577)
chr2 (328-387)||(16523098-16523157)
chr2 (235-270)||(16900100-16900135)
chr2 (235-270)||(16993491-16993526)
chr2 (222-277)||(23732274-23732328)
chr2 (328-387)||(27109151-27109210)
chr2 (222-277)||(30215816-30215871)
chr2 (328-387)||(31909311-31909370)
chr2 (222-273)||(31909428-31909478)
chr2 (222-277)||(36815780-36815835)
chr2 (222-273)||(37228733-37228784)
chr2 (328-387)||(40125075-40125134)
chr2 (222-277)||(40125234-40125289)
chr2 (222-277)||(43671934-43671989)
chr2 (328-387)||(43672041-43672100)
chr2 (222-273)||(44994010-44994061)
chr2 (222-268)||(29831814-29831860)
chr2 (223-276)||(4842865-4842918)
chr2 (221-274)||(23732038-23732091)
chr2 (329-381)||(1295385-1295437)
chr2 (225-273)||(3832586-3832634)
chr2 (225-273)||(13850833-13850881)
chr2 (222-274)||(14393077-14393128)
chr2 (234-278)||(33576030-33576074)
chr2 (222-270)||(45442316-45442364)
chr2 (328-383)||(2481302-2481357)
chr2 (336-387)||(3832388-3832439)
chr2 (328-387)||(4042722-4042781)
chr2 (235-278)||(4423968-4424011)
chr2 (235-278)||(4794203-4794246)
chr2 (328-387)||(10671739-10671798)
chr2 (222-269)||(13215318-13215365)
chr2 (235-278)||(16523062-16523105)
chr2 (222-269)||(20658362-20658409)
chr2 (242-277)||(26708149-26708184)
chr2 (222-273)||(26709696-26709747)
chr2 (336-387)||(34317915-34317966)
chr2 (222-277)||(35155564-35155619)
chr2 (336-387)||(35686173-35686224)
chr2 (222-277)||(37910756-37910811)
chr2 (328-387)||(37910952-37911011)
chr2 (328-383)||(41451946-41452001)
chr2 (222-277)||(43672263-43672318)
chr2 (328-382)||(1696230-1696284)
chr2 (227-273)||(4794422-4794468)
chr2 (333-387)||(13215257-13215311)
chr2 (328-370)||(29182277-29182319)
chr2 (235-269)||(29831885-29831919)
chr2 (328-358)||(37228831-37228861)
chr2 (235-277)||(38732078-38732120)
chr2 (329-387)||(44559241-44559299)
chr2 (334-387)||(13850635-13850688)
chr2 (224-277)||(25299747-25299800)
chr2 (222-263)||(32691594-32691635)
chr2 (224-277)||(44993806-44993858)
chr2 (235-275)||(1138055-1138095)
chr2 (225-277)||(1295492-1295544)
chr2 (339-387)||(5164328-5164376)
chr2 (222-270)||(13802486-13802534)
chr2 (225-277)||(19831511-19831563)
chr2 (224-272)||(29182392-29182440)
chr2 (332-392)||(35155405-35155465)
chr2 (221-277)||(38231430-38231486)
chr2 (332-380)||(38231544-38231592)
chr2 (222-274)||(43592328-43592380)
[»] chr1 (260 HSPs)
chr1 (222-399)||(18473272-18473451)
chr1 (222-399)||(32728870-32729049)
chr1 (221-399)||(7001717-7001898)
chr1 (222-399)||(14007489-14007666)
chr1 (222-395)||(41358488-41358663)
chr1 (222-399)||(31258339-31258519)
chr1 (222-399)||(3679626-3679803)
chr1 (222-399)||(12361011-12361190)
chr1 (221-399)||(48955886-48956067)
chr1 (222-399)||(19622655-19622835)
chr1 (222-399)||(26061956-26062136)
chr1 (222-399)||(22919684-22919861)
chr1 (222-399)||(45290457-45290636)
chr1 (221-399)||(35307931-35308112)
chr1 (222-399)||(41881093-41881273)
chr1 (222-399)||(13259988-13260165)
chr1 (221-399)||(24649349-24649529)
chr1 (222-398)||(29688254-29688428)
chr1 (222-389)||(990088-990256)
chr1 (221-389)||(44641266-44641433)
chr1 (222-399)||(33379888-33380066)
chr1 (222-399)||(21383104-21383281)
chr1 (222-399)||(32454111-32454294)
chr1 (225-399)||(21391199-21391371)
chr1 (223-399)||(4323829-4324008)
chr1 (221-399)||(26191358-26191537)
chr1 (321-399)||(2733285-2733363)
chr1 (222-397)||(13770489-13770666)
chr1 (225-390)||(15335124-15335292)
chr1 (321-399)||(32626714-32626792)
chr1 (322-399)||(18302204-18302281)
chr1 (225-399)||(18899956-18900130)
chr1 (321-399)||(10552134-10552212)
chr1 (321-399)||(17984517-17984595)
chr1 (321-398)||(1159662-1159739)
chr1 (222-398)||(11822004-11822181)
chr1 (326-399)||(35005491-35005564)
chr1 (222-399)||(52254183-52254360)
chr1 (222-399)||(50429031-50429209)
chr1 (222-399)||(26442721-26442899)
chr1 (222-399)||(7818923-7819103)
chr1 (321-399)||(34383047-34383125)
chr1 (223-399)||(3753214-3753390)
chr1 (322-399)||(4360370-4360447)
chr1 (222-399)||(29072497-29072677)
chr1 (225-399)||(34808200-34808373)
chr1 (322-399)||(16083154-16083231)
chr1 (322-399)||(46868329-46868406)
chr1 (321-399)||(1811092-1811170)
chr1 (321-399)||(20756120-20756198)
chr1 (322-392)||(33067559-33067629)
chr1 (345-399)||(49226361-49226415)
chr1 (222-279)||(990322-990379)
chr1 (222-279)||(41358369-41358426)
chr1 (224-397)||(45368674-45368847)
chr1 (322-399)||(48609416-48609493)
chr1 (222-277)||(1810927-1810982)
chr1 (222-277)||(18302332-18302387)
chr1 (222-277)||(45368490-45368545)
chr1 (222-276)||(18473541-18473595)
chr1 (323-397)||(22953380-22953454)
chr1 (223-272)||(7818783-7818832)
chr1 (222-279)||(19622960-19623017)
chr1 (322-399)||(37545773-37545850)
chr1 (223-276)||(44641079-44641132)
chr1 (222-279)||(45290763-45290820)
chr1 (221-277)||(24653801-24653857)
chr1 (221-277)||(29072807-29072863)
chr1 (222-274)||(35005692-35005744)
chr1 (221-277)||(37545627-37545683)
chr1 (221-277)||(38151157-38151213)
chr1 (221-277)||(52254424-52254480)
chr1 (222-277)||(3753517-3753572)
chr1 (222-277)||(6567441-6567496)
chr1 (222-277)||(13260266-13260321)
chr1 (222-277)||(21391096-21391151)
chr1 (222-277)||(24507788-24507843)
chr1 (222-399)||(26142420-26142591)
chr1 (222-277)||(33045635-33045690)
chr1 (222-277)||(35005444-35005499)
chr1 (222-277)||(35307715-35307770)
chr1 (222-277)||(38164240-38164295)
chr1 (222-277)||(47819232-47819287)
chr1 (222-277)||(47819541-47819596)
chr1 (222-277)||(50799130-50799185)
chr1 (225-279)||(31258645-31258699)
chr1 (223-277)||(44157696-44157750)
chr1 (221-274)||(26191682-26191735)
chr1 (221-278)||(46868521-46868578)
chr1 (225-277)||(3247507-3247559)
chr1 (221-277)||(3679931-3679987)
chr1 (221-277)||(10631163-10631219)
chr1 (221-277)||(16060830-16060886)
chr1 (221-273)||(17984650-17984702)
chr1 (221-277)||(24507478-24507534)
chr1 (221-277)||(24977777-24977833)
chr1 (222-274)||(26442563-26442615)
chr1 (322-399)||(27521676-27521755)
chr1 (221-277)||(35056529-35056585)
chr1 (221-277)||(38136926-38136982)
chr1 (225-277)||(38163934-38163986)
chr1 (221-277)||(40718109-40718165)
chr1 (221-277)||(45380581-45380637)
chr1 (221-277)||(45638579-45638635)
chr1 (328-392)||(48730445-48730509)
chr1 (222-277)||(3247198-3247253)
chr1 (222-277)||(8140434-8140489)
chr1 (222-277)||(8140744-8140799)
chr1 (222-277)||(10631473-10631528)
chr1 (222-277)||(11822310-11822365)
chr1 (222-277)||(12158690-12158745)
chr1 (222-277)||(12360913-12360968)
chr1 (222-277)||(15516582-15516637)
chr1 (222-277)||(15526307-15526362)
chr1 (222-277)||(16026883-16026938)
chr1 (222-273)||(17984333-17984384)
chr1 (222-277)||(19720712-19720767)
chr1 (226-277)||(24649605-24649656)
chr1 (222-277)||(26324585-26324640)
chr1 (222-277)||(30322929-30322984)
chr1 (222-277)||(30323238-30323293)
chr1 (222-277)||(32626529-32626584)
chr1 (222-277)||(33000305-33000360)
chr1 (222-277)||(33000614-33000669)
chr1 (222-277)||(33234546-33234601)
chr1 (222-277)||(34002885-34002940)
chr1 (222-277)||(35056839-35056894)
chr1 (222-277)||(39747780-39747835)
chr1 (222-277)||(45380272-45380327)
chr1 (222-277)||(48609236-48609291)
chr1 (222-273)||(48609543-48609594)
chr1 (222-273)||(48955714-48955765)
chr1 (227-277)||(2939934-2939984)
chr1 (222-276)||(10887544-10887598)
chr1 (222-276)||(16026573-16026627)
chr1 (221-271)||(22953507-22953557)
chr1 (223-277)||(27521577-27521631)
chr1 (223-277)||(39303675-39303729)
chr1 (222-276)||(44157988-44158042)
chr1 (224-277)||(4789310-4789363)
chr1 (342-399)||(39303817-39303874)
chr1 (221-277)||(12322915-12322971)
chr1 (336-392)||(18079516-18079572)
chr1 (225-277)||(18899842-18899894)
chr1 (225-277)||(19721019-19721071)
chr1 (222-274)||(22919925-22919977)
chr1 (221-277)||(31060786-31060842)
chr1 (221-277)||(33234857-33234913)
chr1 (222-274)||(37624746-37624798)
chr1 (225-277)||(38150851-38150903)
chr1 (221-277)||(41738795-41738851)
chr1 (222-277)||(7867129-7867184)
chr1 (222-277)||(8364861-8364916)
chr1 (222-277)||(10887233-10887288)
chr1 (223-274)||(15058419-15058470)
chr1 (332-387)||(18927890-18927945)
chr1 (332-387)||(19198781-19198836)
chr1 (222-277)||(21383373-21383428)
chr1 (328-387)||(24510051-24510110)
chr1 (222-277)||(24654112-24654167)
chr1 (222-277)||(24978067-24978122)
chr1 (222-273)||(26324896-26324947)
chr1 (222-277)||(33045355-33045410)
chr1 (221-276)||(39025328-39025382)
chr1 (224-275)||(46183686-46183737)
chr1 (234-276)||(292871-292913)
chr1 (222-264)||(18079618-18079660)
chr1 (223-277)||(32420099-32420153)
chr1 (225-274)||(7350426-7350475)
chr1 (328-381)||(8364814-8364867)
chr1 (224-277)||(17129691-17129744)
chr1 (224-277)||(26207280-26207333)
chr1 (222-277)||(41739068-41739120)
chr1 (225-277)||(5058937-5058989)
chr1 (221-277)||(15211803-15211859)
chr1 (221-277)||(20948754-20948810)
chr1 (221-277)||(25658013-25658069)
chr1 (222-274)||(33067348-33067400)
chr1 (221-277)||(40718419-40718475)
chr1 (222-270)||(45638846-45638894)
chr1 (222-277)||(4360571-4360626)
chr1 (328-387)||(4789417-4789476)
chr1 (222-277)||(7867302-7867357)
chr1 (328-387)||(10887342-10887401)
chr1 (332-387)||(12322718-12322773)
chr1 (222-277)||(12360603-12360658)
chr1 (328-387)||(12360712-12360771)
chr1 (222-273)||(14007824-14007875)
chr1 (222-273)||(15211511-15211562)
chr1 (222-273)||(16060596-16060646)
chr1 (328-387)||(16060704-16060763)
chr1 (222-273)||(16083047-16083098)
chr1 (328-387)||(17129916-17129975)
chr1 (222-277)||(18079398-18079453)
chr1 (222-277)||(28507403-28507458)
chr1 (222-277)||(31061096-31061151)
chr1 (223-270)||(33067682-33067729)
chr1 (222-273)||(42482979-42483030)
chr1 (222-277)||(50428873-50428928)
chr1 (222-272)||(15058716-15058766)
chr1 (227-273)||(16083348-16083394)
chr1 (224-270)||(17130035-17130081)
chr1 (239-277)||(18302070-18302108)
chr1 (224-274)||(22953258-22953308)
chr1 (225-279)||(26062201-26062255)
chr1 (221-274)||(33380204-33380258)
chr1 (223-273)||(34382948-34382997)
chr1 (333-383)||(42483167-42483217)
chr1 (224-274)||(48730565-48730615)
chr1 (222-276)||(49073691-49073745)
chr1 (328-370)||(49073902-49073944)
chr1 (225-274)||(7350684-7350733)
chr1 (338-387)||(24977898-24977947)
chr1 (224-277)||(25658246-25658299)
chr1 (330-367)||(32420208-32420245)
chr1 (221-277)||(1159784-1159840)
chr1 (328-380)||(19720913-19720965)
chr1 (335-387)||(34002691-34002743)
chr1 (225-277)||(46183999-46184051)
chr1 (321-364)||(292959-293002)
chr1 (222-277)||(4565281-4565336)
chr1 (235-278)||(7350620-7350663)
chr1 (328-383)||(10631364-10631419)
chr1 (235-278)||(10887306-10887349)
chr1 (336-387)||(15466249-15466300)
chr1 (328-383)||(16026774-16026829)
chr1 (222-273)||(22674203-22674254)
chr1 (221-272)||(24510258-24510309)
chr1 (328-379)||(26324787-26324838)
chr1 (328-383)||(33000505-33000560)
chr1 (328-383)||(38150957-38151012)
chr1 (222-277)||(39747474-39747528)
chr1 (336-387)||(41738913-41738964)
chr1 (222-269)||(42483224-42483271)
chr1 (235-278)||(46183757-46183800)
chr1 (222-273)||(46868226-46868277)
chr1 (222-277)||(49923763-49923818)
chr1 (332-382)||(5058838-5058888)
chr1 (223-277)||(19198894-19198948)
chr1 (235-277)||(26324832-26324874)
chr1 (235-269)||(28507188-28507222)
chr1 (222-264)||(36912853-36912895)
chr1 (223-273)||(37624976-37625026)
chr1 (221-274)||(12322603-12322656)
chr1 (223-264)||(26142630-26142671)
chr1 (224-277)||(29579322-29579375)
chr1 (338-387)||(33045475-33045524)
chr1 (335-392)||(37624802-37624859)
chr1 (240-277)||(37646760-37646797)
chr1 (225-274)||(39025112-39025161)
chr1 (338-387)||(39747592-39747641)
chr1 (338-387)||(44157874-44157923)
chr1 (342-387)||(46183812-46183857)
chr1 (222-279)||(47038866-47038923)
chr1 (225-273)||(8364619-8364667)
chr1 (222-270)||(15334917-15334965)
chr1 (221-277)||(15466131-15466187)
chr1 (223-275)||(18928089-18928141)
chr1 (221-277)||(34383189-34383245)
chr1 (336-380)||(51986415-51986459)
[»] chr4 (267 HSPs)
chr4 (221-399)||(50714386-50714566)
chr4 (222-399)||(6827694-6827874)
chr4 (222-398)||(35415299-35415478)
chr4 (222-399)||(51708848-51709027)
chr4 (221-399)||(55482291-55482469)
chr4 (222-399)||(16712514-16712691)
chr4 (222-398)||(41620077-41620256)
chr4 (223-399)||(13479273-13479449)
chr4 (222-399)||(36702000-36702179)
chr4 (225-399)||(38054549-38054724)
chr4 (222-399)||(32208542-32208720)
chr4 (222-399)||(52017690-52017870)
chr4 (222-398)||(13064159-13064335)
chr4 (222-399)||(41346039-41346218)
chr4 (222-397)||(29463736-29463913)
chr4 (222-398)||(22584432-22584607)
chr4 (222-399)||(41920905-41921084)
chr4 (221-399)||(4279155-4279336)
chr4 (321-399)||(34355065-34355143)
chr4 (321-399)||(34361966-34362044)
chr4 (227-399)||(27008228-27008401)
chr4 (222-398)||(35763776-35763955)
chr4 (222-399)||(45593228-45593404)
chr4 (225-399)||(51545791-51545966)
chr4 (222-399)||(18205156-18205334)
chr4 (321-399)||(27427944-27428022)
chr4 (222-399)||(55072389-55072569)
chr4 (222-399)||(9289266-9289442)
chr4 (222-396)||(24474786-24474963)
chr4 (221-389)||(53717004-53717175)
chr4 (222-399)||(9446145-9446323)
chr4 (321-399)||(18135936-18136014)
chr4 (321-399)||(49123144-49123222)
chr4 (225-399)||(5063013-5063183)
chr4 (222-399)||(32365094-32365273)
chr4 (321-396)||(123718-123793)
chr4 (321-398)||(3178784-3178861)
chr4 (222-399)||(52441763-52441939)
chr4 (222-399)||(45505713-45505894)
chr4 (221-399)||(2180394-2180573)
chr4 (321-399)||(46087860-46087936)
chr4 (222-399)||(22099732-22099912)
chr4 (340-398)||(50822120-50822178)
chr4 (321-398)||(18830946-18831023)
chr4 (221-277)||(27008083-27008139)
chr4 (221-279)||(35415576-35415634)
chr4 (222-279)||(35763647-35763704)
chr4 (222-279)||(41345853-41345910)
chr4 (222-277)||(13064410-13064465)
chr4 (222-277)||(52017505-52017560)
chr4 (225-279)||(15555506-15555560)
chr4 (225-279)||(41619902-41619956)
chr4 (221-279)||(50714239-50714297)
chr4 (333-399)||(52429825-52429891)
chr4 (222-279)||(123534-123591)
chr4 (221-274)||(22099542-22099595)
chr4 (221-277)||(23245230-23245286)
chr4 (222-278)||(29380668-29380724)
chr4 (221-277)||(35464327-35464383)
chr4 (221-277)||(42848336-42848392)
chr4 (222-278)||(46088004-46088060)
chr4 (221-277)||(46115413-46115469)
chr4 (221-277)||(46128547-46128603)
chr4 (222-277)||(2034800-2034855)
chr4 (222-277)||(2180220-2180275)
chr4 (222-277)||(8760604-8760659)
chr4 (222-277)||(13479556-13479611)
chr4 (222-277)||(13530658-13530713)
chr4 (222-277)||(24774045-24774100)
chr4 (222-277)||(29499182-29499237)
chr4 (222-277)||(30046737-30046792)
chr4 (222-277)||(30061078-30061133)
chr4 (222-277)||(32365428-32365483)
chr4 (222-277)||(43231334-43231389)
chr4 (222-277)||(45505600-45505655)
chr4 (223-277)||(11285504-11285558)
chr4 (223-273)||(15555587-15555637)
chr4 (222-272)||(23778964-23779014)
chr4 (222-276)||(28809126-28809180)
chr4 (222-279)||(6827546-6827603)
chr4 (222-279)||(9289582-9289639)
chr4 (224-277)||(9445951-9446004)
chr4 (222-392)||(29420365-29420537)
chr4 (222-279)||(51708693-51708750)
chr4 (222-278)||(4211561-4211617)
chr4 (222-274)||(5052532-5052584)
chr4 (221-277)||(8191336-8191392)
chr4 (222-270)||(8904886-8904934)
chr4 (221-277)||(13073758-13073814)
chr4 (221-277)||(26412529-26412585)
chr4 (222-274)||(29380858-29380910)
chr4 (225-277)||(29499491-29499543)
chr4 (222-274)||(34361803-34361855)
chr4 (221-277)||(46292391-46292447)
chr4 (225-277)||(55072657-55072709)
chr4 (222-277)||(5827918-5827973)
chr4 (222-277)||(5882552-5882606)
chr4 (222-277)||(8760726-8760781)
chr4 (328-387)||(11692870-11692929)
chr4 (222-277)||(12791919-12791974)
chr4 (222-277)||(13631228-13631283)
chr4 (222-277)||(13631544-13631599)
chr4 (222-277)||(14487802-14487857)
chr4 (222-277)||(14791751-14791806)
chr4 (222-277)||(25423924-25423979)
chr4 (222-277)||(25424257-25424312)
chr4 (222-277)||(35464018-35464073)
chr4 (222-277)||(43231088-43231143)
chr4 (222-277)||(46115724-46115779)
chr4 (222-277)||(46128858-46128913)
chr4 (222-273)||(46292600-46292651)
chr4 (221-272)||(47274180-47274231)
chr4 (222-273)||(51545629-51545680)
chr4 (222-277)||(52430045-52430100)
chr4 (222-277)||(52442037-52442092)
chr4 (222-277)||(53915683-53915738)
chr4 (222-277)||(54903420-54903475)
chr4 (223-277)||(6353583-6353637)
chr4 (222-276)||(32208847-32208901)
chr4 (223-277)||(36702308-36702362)
chr4 (223-277)||(51763147-51763201)
chr4 (328-381)||(7642491-7642544)
chr4 (224-277)||(18205468-18205521)
chr4 (224-399)||(43368467-43368644)
chr4 (224-277)||(51830891-51830944)
chr4 (221-277)||(5827654-5827710)
chr4 (222-274)||(13074073-13074125)
chr4 (221-277)||(19321804-19321860)
chr4 (328-392)||(25358396-25358460)
chr4 (221-277)||(28809010-28809066)
chr4 (225-277)||(30060772-30060824)
chr4 (221-277)||(31560640-31560696)
chr4 (221-277)||(41324835-41324891)
chr4 (221-277)||(53308013-53308069)
chr4 (222-274)||(53716921-53716973)
chr4 (222-277)||(4279022-4279077)
chr4 (328-387)||(5797652-5797711)
chr4 (222-277)||(11693066-11693121)
chr4 (222-277)||(12152438-12152493)
chr4 (328-387)||(13530488-13530547)
chr4 (222-277)||(13764613-13764668)
chr4 (222-277)||(14488132-14488187)
chr4 (222-273)||(20291986-20292037)
chr4 (222-273)||(22584287-22584338)
chr4 (222-277)||(23245540-23245595)
chr4 (222-277)||(23779170-23779225)
chr4 (328-387)||(25424144-25424203)
chr4 (222-277)||(26412190-26412245)
chr4 (222-277)||(27427872-27427926)
chr4 (222-273)||(28448834-28448885)
chr4 (222-277)||(31560331-31560386)
chr4 (222-277)||(31812158-31812213)
chr4 (222-277)||(34355228-34355283)
chr4 (222-277)||(35119292-35119347)
chr4 (222-277)||(36054095-36054150)
chr4 (222-277)||(42848027-42848082)
chr4 (222-273)||(45474545-45474596)
chr4 (222-277)||(45593531-45593586)
chr4 (222-277)||(53915992-53916047)
chr4 (235-277)||(2034552-2034594)
chr4 (223-277)||(2322094-2322148)
chr4 (328-370)||(5827764-5827806)
chr4 (224-274)||(19903603-19903653)
chr4 (223-277)||(36050289-36050343)
chr4 (223-277)||(37557140-37557194)
chr4 (223-277)||(44925790-44925844)
chr4 (227-279)||(123840-123893)
chr4 (322-399)||(11285605-11285682)
chr4 (224-273)||(16712331-16712380)
chr4 (224-277)||(18831123-18831176)
chr4 (221-270)||(29463609-29463658)
chr4 (224-277)||(30564835-30564888)
chr4 (328-381)||(51738309-51738362)
chr4 (221-274)||(55805036-55805089)
chr4 (225-276)||(5202929-5202981)
chr4 (225-273)||(14791502-14791550)
chr4 (225-277)||(20144423-20144475)
chr4 (222-274)||(24474600-24474651)
chr4 (221-277)||(25358485-25358541)
chr4 (225-273)||(54208774-54208822)
chr4 (222-277)||(2322377-2322432)
chr4 (328-387)||(4211610-4211669)
chr4 (222-277)||(12152154-12152209)
chr4 (222-277)||(13530379-13530434)
chr4 (222-277)||(18136058-18136113)
chr4 (222-277)||(19321570-19321625)
chr4 (222-277)||(19903261-19903316)
chr4 (328-387)||(24774259-24774318)
chr4 (222-277)||(26314277-26314332)
chr4 (222-277)||(31182449-31182504)
chr4 (222-277)||(31811925-31811980)
chr4 (225-277)||(34354972-34355020)
chr4 (235-278)||(36050359-36050402)
chr4 (328-387)||(36050395-36050454)
chr4 (222-277)||(37556841-37556896)
chr4 (222-277)||(42823776-42823831)
chr4 (222-273)||(44925485-44925536)
chr4 (225-276)||(47022743-47022794)
chr4 (222-277)||(47023050-47023105)
chr4 (328-383)||(47135887-47135942)
chr4 (223-274)||(47136119-47136170)
chr4 (222-277)||(49123266-49123321)
chr4 (222-277)||(51738137-51738192)
chr4 (222-277)||(51738356-51738411)
chr4 (238-277)||(54208477-54208516)
chr4 (328-387)||(54208657-54208716)
chr4 (222-276)||(11692762-11692816)
chr4 (328-382)||(12791811-12791865)
chr4 (222-272)||(31370804-31370854)
chr4 (322-392)||(8191216-8191288)
chr4 (328-381)||(14488025-14488078)
chr4 (224-277)||(35420393-35420446)
chr4 (224-277)||(35420648-35420701)
chr4 (333-382)||(41439902-41439951)
chr4 (221-274)||(42824039-42824092)
chr4 (225-277)||(5797484-5797536)
chr4 (225-277)||(5797765-5797817)
chr4 (222-274)||(13764755-13764807)
chr4 (222-274)||(14594206-14594258)
chr4 (326-358)||(14791727-14791759)
chr4 (222-270)||(20144683-20144731)
chr4 (221-277)||(26313987-26314043)
chr4 (328-380)||(29380717-29380769)
chr4 (222-274)||(35119559-35119611)
chr4 (328-392)||(46292441-46292505)
chr4 (225-277)||(50822013-50822065)
chr4 (222-270)||(52543422-52543470)
chr4 (221-276)||(8905180-8905235)
chr4 (223-254)||(12791610-12791641)
chr4 (328-387)||(19903370-19903429)
chr4 (235-278)||(24774311-24774354)
chr4 (234-277)||(25358454-25358497)
chr4 (235-278)||(31811996-31812039)
chr4 (336-387)||(35119380-35119431)
chr4 (225-272)||(41920771-41920818)
chr4 (328-383)||(42848227-42848282)
chr4 (328-387)||(46115611-46115670)
chr4 (328-387)||(46128745-46128804)
chr4 (328-387)||(47022937-47022996)
chr4 (235-278)||(47135851-47135894)
chr4 (222-277)||(51762870-51762925)
chr4 (235-278)||(51763086-51763129)
chr4 (338-380)||(2034693-2034735)
chr4 (235-277)||(5797705-5797747)
chr4 (235-277)||(11692834-11692876)
chr4 (235-277)||(13530452-13530494)
chr4 (235-277)||(20144492-20144534)
chr4 (235-277)||(25424197-25424239)
chr4 (323-381)||(28449065-28449123)
chr4 (240-278)||(47022989-47023027)
chr4 (227-277)||(47532617-47532667)
chr4 (240-278)||(54208709-54208747)
chr4 (332-369)||(12152343-12152380)
chr4 (235-276)||(14594453-14594494)
chr4 (225-274)||(18135793-18135841)
chr4 (225-274)||(49123000-49123048)
chr4 (328-381)||(50754094-50754146)
chr4 (235-276)||(54903362-54903403)
chr4 (235-275)||(2034741-2034781)
chr4 (331-383)||(19321682-19321734)
chr4 (226-274)||(20292237-20292284)
chr4 (222-270)||(28449166-28449214)
chr4 (221-277)||(43368722-43368778)
chr4 (225-277)||(50753925-50753977)
chr4 (328-380)||(52543568-52543620)
chr4 (221-273)||(52642129-52642181)
chr4 (336-380)||(54903315-54903359)
[»] scaffold0370 (1 HSPs)
scaffold0370 (222-399)||(110-289)
[»] chr8 (231 HSPs)
chr8 (221-397)||(4375691-4375867)
chr8 (223-399)||(4016906-4017082)
chr8 (222-395)||(19494119-19494294)
chr8 (222-399)||(38930302-38930481)
chr8 (222-399)||(1525809-1525989)
chr8 (222-399)||(33636322-33636502)
chr8 (222-399)||(16643864-16644044)
chr8 (223-399)||(6146769-6146948)
chr8 (222-399)||(28398860-28399035)
chr8 (221-399)||(1162908-1163091)
chr8 (222-399)||(8094479-8094659)
chr8 (221-399)||(16789194-16789370)
chr8 (222-399)||(24187569-24187746)
chr8 (221-399)||(10776319-10776500)
chr8 (222-384)||(40492960-40493117)
chr8 (222-399)||(1408175-1408353)
chr8 (222-399)||(24954832-24955010)
chr8 (223-399)||(6146517-6146694)
chr8 (321-398)||(21509796-21509873)
chr8 (321-399)||(14495221-14495299)
chr8 (222-399)||(22650464-22650646)
chr8 (321-399)||(22917748-22917826)
chr8 (321-399)||(25131210-25131288)
chr8 (222-399)||(27341411-27341591)
chr8 (322-399)||(21125842-21125919)
chr8 (222-399)||(40066497-40066673)
chr8 (222-399)||(7272420-7272600)
chr8 (222-399)||(14488716-14488894)
chr8 (321-398)||(32040195-32040272)
chr8 (225-379)||(1685117-1685274)
chr8 (221-399)||(33526051-33526232)
chr8 (322-399)||(15719758-15719835)
chr8 (222-399)||(14238751-14238929)
chr8 (222-399)||(29158354-29158534)
chr8 (222-399)||(29487932-29488110)
chr8 (322-399)||(19963099-19963176)
chr8 (222-398)||(14496816-14496991)
chr8 (321-399)||(18549305-18549383)
chr8 (321-399)||(30337023-30337101)
chr8 (322-399)||(10755352-10755429)
chr8 (222-279)||(19494356-19494413)
chr8 (222-279)||(22917564-22917621)
chr8 (322-399)||(32418500-32418577)
chr8 (322-399)||(43477334-43477411)
chr8 (322-399)||(43727251-43727328)
chr8 (221-277)||(4621299-4621355)
chr8 (222-277)||(14239025-14239080)
chr8 (222-277)||(21125719-21125774)
chr8 (222-277)||(43477163-43477218)
chr8 (222-399)||(35143667-35143844)
chr8 (222-279)||(1526115-1526172)
chr8 (322-399)||(7578352-7578429)
chr8 (222-279)||(16643661-16643718)
chr8 (322-399)||(40844357-40844434)
chr8 (221-277)||(2728542-2728598)
chr8 (221-277)||(7272696-7272752)
chr8 (221-277)||(7326366-7326422)
chr8 (222-274)||(32418318-32418370)
chr8 (221-277)||(35097637-35097693)
chr8 (221-277)||(40066765-40066821)
chr8 (221-277)||(40844155-40844211)
chr8 (222-277)||(4017245-4017300)
chr8 (222-277)||(4710165-4710220)
chr8 (222-277)||(11019802-11019857)
chr8 (222-277)||(11976373-11976428)
chr8 (222-277)||(14495069-14495124)
chr8 (221-276)||(25131393-25131448)
chr8 (222-277)||(28346394-28346449)
chr8 (222-277)||(28346703-28346758)
chr8 (222-277)||(32726216-32726271)
chr8 (222-277)||(33526357-33526412)
chr8 (222-277)||(34963300-34963355)
chr8 (222-277)||(37536086-37536141)
chr8 (222-275)||(8094788-8094841)
chr8 (222-279)||(38930607-38930664)
chr8 (221-277)||(1778563-1778619)
chr8 (221-277)||(7185949-7186005)
chr8 (221-277)||(8298586-8298642)
chr8 (221-277)||(10873225-10873281)
chr8 (221-277)||(14489018-14489074)
chr8 (221-277)||(34963609-34963665)
chr8 (221-277)||(35346628-35346684)
chr8 (221-277)||(37536364-37536420)
chr8 (221-277)||(42133099-42133155)
chr8 (222-277)||(3511906-3511961)
chr8 (222-277)||(3512211-3512266)
chr8 (222-277)||(4473989-4474044)
chr8 (222-277)||(7326086-7326141)
chr8 (222-277)||(7420230-7420285)
chr8 (222-277)||(7420535-7420590)
chr8 (222-277)||(8298920-8298975)
chr8 (222-277)||(9496668-9496723)
chr8 (222-277)||(10337119-10337174)
chr8 (222-277)||(10337394-10337449)
chr8 (222-277)||(10540727-10540782)
chr8 (222-277)||(10872915-10872970)
chr8 (222-277)||(11019520-11019575)
chr8 (222-277)||(13154886-13154941)
chr8 (222-277)||(16789075-16789130)
chr8 (222-273)||(18549201-18549252)
chr8 (222-277)||(20277692-20277747)
chr8 (222-277)||(20984146-20984201)
chr8 (222-277)||(21064319-21064374)
chr8 (222-277)||(21125966-21126021)
chr8 (222-277)||(24187842-24187897)
chr8 (222-277)||(25131111-25131166)
chr8 (222-277)||(25600542-25600597)
chr8 (328-387)||(28497363-28497422)
chr8 (222-277)||(32725907-32725962)
chr8 (222-277)||(35097328-35097383)
chr8 (328-387)||(35115531-35115590)
chr8 (222-277)||(35345562-35345617)
chr8 (222-277)||(35346943-35346998)
chr8 (222-276)||(5357423-5357477)
chr8 (222-276)||(10540449-10540503)
chr8 (222-276)||(10755474-10755528)
chr8 (221-275)||(15719655-15719709)
chr8 (223-273)||(24090437-24090487)
chr8 (222-276)||(28323849-28323903)
chr8 (222-268)||(30337171-30337217)
chr8 (223-275)||(14495337-14495389)
chr8 (224-277)||(18549518-18549571)
chr8 (225-277)||(11976681-11976733)
chr8 (225-277)||(13232201-13232253)
chr8 (222-274)||(20278005-20278057)
chr8 (222-274)||(21064632-21064684)
chr8 (225-277)||(28497564-28497616)
chr8 (225-277)||(40844480-40844532)
chr8 (221-277)||(42132863-42132919)
chr8 (222-277)||(2728232-2728287)
chr8 (222-277)||(4473704-4473759)
chr8 (222-277)||(6469280-6469335)
chr8 (328-387)||(8298696-8298755)
chr8 (222-277)||(9496341-9496396)
chr8 (221-272)||(13232512-13232563)
chr8 (222-277)||(17073807-17073862)
chr8 (222-277)||(17574408-17574463)
chr8 (222-277)||(20984455-20984510)
chr8 (222-277)||(25600230-25600285)
chr8 (321-392)||(32195381-32195452)
chr8 (222-277)||(35115584-35115639)
chr8 (221-279)||(1163217-1163275)
chr8 (224-270)||(10776150-10776196)
chr8 (223-277)||(13779477-13779531)
chr8 (222-276)||(27117922-27117976)
chr8 (221-267)||(40493112-40493158)
chr8 (328-381)||(20277801-20277854)
chr8 (328-381)||(21064428-21064481)
chr8 (221-274)||(29158617-29158670)
chr8 (225-273)||(9175320-9175368)
chr8 (222-274)||(28497255-28497307)
chr8 (222-274)||(42430068-42430120)
chr8 (333-388)||(2811555-2811610)
chr8 (222-277)||(3680746-3680801)
chr8 (222-273)||(4375960-4376010)
chr8 (328-387)||(6469498-6469557)
chr8 (328-387)||(7326195-7326254)
chr8 (235-278)||(7420303-7420346)
chr8 (328-387)||(7420339-7420398)
chr8 (222-277)||(9175012-9175067)
chr8 (222-277)||(13155196-13155251)
chr8 (235-278)||(13232271-13232314)
chr8 (222-277)||(19962995-19963050)
chr8 (235-278)||(20277765-20277808)
chr8 (235-278)||(21064392-21064435)
chr8 (326-381)||(23939654-23939709)
chr8 (227-274)||(24814710-24814757)
chr8 (222-277)||(24815013-24815068)
chr8 (222-277)||(25702512-25702567)
chr8 (222-277)||(27117753-27117808)
chr8 (222-277)||(28324126-28324181)
chr8 (328-387)||(29992133-29992192)
chr8 (222-277)||(29992245-29992300)
chr8 (222-273)||(31445412-31445463)
chr8 (222-277)||(32040075-32040130)
chr8 (225-272)||(33652193-33652240)
chr8 (328-387)||(42429952-42430011)
chr8 (235-278)||(42430004-42430047)
chr8 (221-271)||(1408004-1408054)
chr8 (222-276)||(2355887-2355941)
chr8 (227-277)||(3680532-3680582)
chr8 (223-273)||(5357712-5357762)
chr8 (222-264)||(9908918-9908960)
chr8 (333-387)||(15931101-15931155)
chr8 (224-274)||(43727382-43727431)
chr8 (334-387)||(9175204-9175257)
chr8 (224-277)||(13779151-13779204)
chr8 (221-258)||(28398755-28398792)
chr8 (221-274)||(29487749-29487802)
chr8 (224-277)||(43727097-43727150)
chr8 (328-380)||(1778673-1778725)
chr8 (225-273)||(2811730-2811778)
chr8 (328-388)||(10873112-10873172)
chr8 (328-380)||(13154995-13155047)
chr8 (328-380)||(24814814-24814866)
chr8 (222-274)||(28258189-28258241)
chr8 (225-273)||(29991918-29991966)
chr8 (222-270)||(44997931-44997979)
chr8 (234-277)||(1778874-1778917)
chr8 (235-278)||(4473777-4473820)
chr8 (328-387)||(4473813-4473872)
chr8 (235-278)||(10540522-10540565)
chr8 (328-383)||(11976572-11976627)
chr8 (328-387)||(13232307-13232366)
chr8 (241-276)||(14847844-14847879)
chr8 (326-381)||(17074006-17074061)
chr8 (326-381)||(17574209-17574264)
chr8 (221-272)||(23939546-23939597)
chr8 (222-277)||(26530668-26530723)
chr8 (223-270)||(36044744-36044791)
chr8 (222-277)||(42429758-42429812)
chr8 (235-277)||(8298660-8298702)
chr8 (328-370)||(10540558-10540600)
chr8 (328-370)||(13779384-13779426)
chr8 (223-277)||(15930933-15930987)
chr8 (235-277)||(17074053-17074095)
chr8 (235-277)||(17574175-17574217)
chr8 (235-277)||(23939620-23939662)
chr8 (223-277)||(30969399-30969453)
chr8 (338-380)||(44998104-44998146)
chr8 (235-277)||(44998149-44998191)
chr8 (221-258)||(30969681-30969718)
chr8 (328-381)||(42132973-42133026)
chr8 (221-274)||(44998211-44998264)
chr8 (331-387)||(2355997-2356053)
chr8 (245-277)||(4709929-4709961)
chr8 (328-364)||(5357618-5357654)
chr8 (241-277)||(13796541-13796577)
chr8 (243-275)||(14848137-14848169)
chr8 (222-270)||(15719931-15719979)
chr8 (222-274)||(27341258-27341310)
[»] chr6 (181 HSPs)
chr6 (222-399)||(7155797-7155976)
chr6 (222-399)||(33801564-33801743)
chr6 (223-399)||(31166871-31167049)
chr6 (222-399)||(15076025-15076204)
chr6 (222-399)||(8680775-8680955)
chr6 (221-398)||(34582528-34582708)
chr6 (222-399)||(32885673-32885852)
chr6 (222-399)||(24692802-24692979)
chr6 (221-398)||(30928867-30929045)
chr6 (222-399)||(317812-317988)
chr6 (222-399)||(543544-543724)
chr6 (321-399)||(14655591-14655669)
chr6 (222-399)||(15962027-15962207)
chr6 (321-399)||(24273939-24274017)
chr6 (225-398)||(10091039-10091212)
chr6 (221-399)||(19296227-19296408)
chr6 (225-399)||(3356322-3356495)
chr6 (222-398)||(777861-778042)
chr6 (225-399)||(1890062-1890239)
chr6 (321-399)||(494583-494661)
chr6 (321-399)||(2616056-2616134)
chr6 (225-398)||(7324015-7324189)
chr6 (321-399)||(15116773-15116851)
chr6 (321-399)||(17321375-17321453)
chr6 (321-399)||(17321508-17321586)
chr6 (321-391)||(31398370-31398440)
chr6 (321-398)||(11129302-11129379)
chr6 (224-398)||(6591263-6591440)
chr6 (222-399)||(26375693-26375871)
chr6 (322-399)||(6468493-6468570)
chr6 (225-399)||(19275862-19276036)
chr6 (322-399)||(21995167-21995244)
chr6 (242-399)||(5286606-5286768)
chr6 (223-389)||(14428651-14428818)
chr6 (222-279)||(7156103-7156160)
chr6 (222-279)||(24274074-24274131)
chr6 (221-277)||(15962334-15962390)
chr6 (222-399)||(12612179-12612359)
chr6 (221-274)||(494404-494457)
chr6 (226-279)||(543365-543418)
chr6 (222-279)||(1890395-1890452)
chr6 (322-399)||(2373314-2373391)
chr6 (222-279)||(8681059-8681116)
chr6 (222-279)||(12419881-12419938)
chr6 (222-279)||(14655379-14655436)
chr6 (222-279)||(22822594-22822651)
chr6 (322-399)||(33131626-33131703)
chr6 (225-277)||(20467354-20467406)
chr6 (225-277)||(26375990-26376042)
chr6 (222-277)||(1007454-1007509)
chr6 (222-277)||(3414387-3414442)
chr6 (222-277)||(3968954-3969009)
chr6 (224-279)||(5286894-5286949)
chr6 (222-399)||(11448537-11448720)
chr6 (222-277)||(21994348-21994403)
chr6 (222-277)||(21995064-21995119)
chr6 (222-277)||(22543354-22543409)
chr6 (222-277)||(25137302-25137357)
chr6 (222-277)||(25431799-25431854)
chr6 (222-277)||(30928681-30928736)
chr6 (222-277)||(34582837-34582892)
chr6 (222-276)||(2615872-2615926)
chr6 (223-277)||(23770162-23770216)
chr6 (221-279)||(31167143-31167201)
chr6 (222-399)||(9896460-9896637)
chr6 (221-274)||(17771910-17771963)
chr6 (222-275)||(22792846-22792899)
chr6 (222-279)||(33808620-33808677)
chr6 (222-274)||(3356142-3356194)
chr6 (225-277)||(12176588-12176640)
chr6 (222-274)||(12419708-12419760)
chr6 (221-277)||(21995370-21995426)
chr6 (225-277)||(34990260-34990312)
chr6 (222-277)||(1007124-1007179)
chr6 (222-277)||(2373179-2373234)
chr6 (222-277)||(3968645-3968700)
chr6 (222-277)||(6412218-6412273)
chr6 (222-277)||(6412524-6412579)
chr6 (222-277)||(6468310-6468365)
chr6 (222-277)||(10910909-10910964)
chr6 (222-277)||(11449114-11449169)
chr6 (222-277)||(12299085-12299140)
chr6 (222-277)||(19690393-19690448)
chr6 (222-277)||(20467663-20467718)
chr6 (222-277)||(21147404-21147459)
chr6 (222-277)||(21385251-21385306)
chr6 (222-277)||(21385529-21385584)
chr6 (222-277)||(22543663-22543718)
chr6 (222-277)||(23502485-23502540)
chr6 (222-277)||(24273828-24273883)
chr6 (222-277)||(25136994-25137049)
chr6 (222-277)||(31198615-31198670)
chr6 (222-277)||(33131795-33131850)
chr6 (222-276)||(13268109-13268163)
chr6 (222-272)||(19321081-19321131)
chr6 (222-279)||(777677-777734)
chr6 (224-277)||(13617531-13617584)
chr6 (342-399)||(23770343-23770400)
chr6 (222-274)||(3276302-3276354)
chr6 (321-369)||(17772014-17772062)
chr6 (222-278)||(19129336-19129392)
chr6 (221-277)||(19267564-19267620)
chr6 (355-399)||(22822391-22822435)
chr6 (221-273)||(24901238-24901290)
chr6 (221-277)||(31186536-31186592)
chr6 (222-277)||(318042-318097)
chr6 (223-274)||(494700-494751)
chr6 (222-277)||(1875502-1875557)
chr6 (222-269)||(2616193-2616240)
chr6 (222-277)||(3414697-3414752)
chr6 (222-269)||(6591115-6591162)
chr6 (222-273)||(8170100-8170151)
chr6 (222-273)||(12757610-12757661)
chr6 (234-277)||(13617761-13617804)
chr6 (222-277)||(14656205-14656260)
chr6 (222-277)||(18024320-18024375)
chr6 (222-277)||(19296108-19296163)
chr6 (222-277)||(21993787-21993842)
chr6 (222-269)||(23502237-23502284)
chr6 (328-387)||(24901347-24901406)
chr6 (221-276)||(30239292-30239347)
chr6 (223-274)||(34989962-34990013)
chr6 (224-274)||(14428898-14428948)
chr6 (222-272)||(17765009-17765059)
chr6 (222-272)||(22822307-22822357)
chr6 (353-399)||(25431672-25431718)
chr6 (223-277)||(30479367-30479421)
chr6 (223-277)||(31276285-31276339)
chr6 (338-387)||(13617648-13617697)
chr6 (222-263)||(23770398-23770439)
chr6 (221-277)||(10910628-10910684)
chr6 (221-269)||(11129496-11129544)
chr6 (225-277)||(18024014-18024066)
chr6 (222-274)||(31398489-31398541)
chr6 (225-276)||(12298825-12298876)
chr6 (328-387)||(12298927-12298986)
chr6 (222-277)||(13150695-13150750)
chr6 (221-272)||(15442936-15442987)
chr6 (222-277)||(19129465-19129520)
chr6 (328-387)||(19320876-19320935)
chr6 (222-277)||(25121441-25121496)
chr6 (328-387)||(31198724-31198783)
chr6 (222-276)||(1214696-1214750)
chr6 (222-276)||(1214942-1214996)
chr6 (235-276)||(6564595-6564636)
chr6 (224-277)||(9896280-9896333)
chr6 (328-365)||(13268218-13268255)
chr6 (224-277)||(19320769-19320822)
chr6 (366-399)||(33808804-33808837)
chr6 (222-258)||(15117004-15117040)
chr6 (235-279)||(19275179-19275223)
chr6 (235-278)||(1007197-1007240)
chr6 (235-278)||(1214767-1214810)
chr6 (328-383)||(3968754-3968809)
chr6 (234-273)||(6564893-6564932)
chr6 (221-272)||(12611994-12612045)
chr6 (222-277)||(14655903-14655958)
chr6 (222-272)||(15116673-15116721)
chr6 (222-277)||(15722610-15722665)
chr6 (328-387)||(15722719-15722778)
chr6 (222-273)||(15722849-15722900)
chr6 (222-277)||(17765320-17765375)
chr6 (328-379)||(25121337-25121388)
chr6 (235-278)||(25137066-25137109)
chr6 (338-381)||(31185753-31185796)
chr6 (235-278)||(31198688-31198731)
chr6 (235-277)||(13268182-13268224)
chr6 (235-277)||(19129405-19129447)
chr6 (223-273)||(23628799-23628849)
chr6 (337-387)||(23628994-23629044)
chr6 (235-277)||(24901311-24901353)
chr6 (328-370)||(25137102-25137144)
chr6 (326-387)||(1214801-1214862)
chr6 (221-274)||(12176384-12176437)
chr6 (235-276)||(17765261-17765302)
chr6 (221-274)||(19690708-19690760)
chr6 (322-399)||(34990136-34990213)
chr6 (245-277)||(7323891-7323923)
chr6 (221-273)||(11925738-11925790)
chr6 (223-267)||(27764914-27764958)
chr6 (225-277)||(31276105-31276157)
[»] chr5 (213 HSPs)
chr5 (221-399)||(18633781-18633962)
chr5 (222-399)||(36577722-36577899)
chr5 (221-399)||(6118315-6118500)
chr5 (221-399)||(28550826-28551005)
chr5 (223-397)||(29172524-29172701)
chr5 (222-399)||(35165980-35166158)
chr5 (222-399)||(5950176-5950352)
chr5 (225-399)||(15635379-15635555)
chr5 (222-399)||(35166986-35167165)
chr5 (222-399)||(5614350-5614530)
chr5 (99-213)||(42026892-42027007)
chr5 (222-399)||(29692913-29693090)
chr5 (221-399)||(29151515-29151696)
chr5 (222-399)||(2217678-2217854)
chr5 (222-398)||(42207242-42207419)
chr5 (222-399)||(29875400-29875579)
chr5 (222-399)||(30800672-30800850)
chr5 (222-399)||(30888160-30888340)
chr5 (222-399)||(23382130-23382297)
chr5 (321-399)||(16616463-16616541)
chr5 (222-399)||(21050575-21050753)
chr5 (321-399)||(27850197-27850275)
chr5 (321-399)||(38962914-38962992)
chr5 (222-399)||(4203456-4203632)
chr5 (222-399)||(10408928-10409110)
chr5 (224-399)||(16038560-16038738)
chr5 (321-399)||(294013-294091)
chr5 (222-399)||(38786159-38786336)
chr5 (221-399)||(33335845-33336027)
chr5 (321-399)||(7075782-7075860)
chr5 (321-399)||(25778982-25779060)
chr5 (321-399)||(31037497-31037575)
chr5 (321-399)||(37090562-37090640)
chr5 (321-399)||(38496521-38496599)
chr5 (221-399)||(25561704-25561887)
chr5 (323-399)||(21125094-21125170)
chr5 (221-398)||(28863656-28863839)
chr5 (222-399)||(34125307-34125484)
chr5 (321-399)||(39379330-39379408)
chr5 (222-397)||(40029141-40029316)
chr5 (321-399)||(18046172-18046250)
chr5 (322-399)||(3850448-3850525)
chr5 (222-397)||(24782099-24782274)
chr5 (222-399)||(10743876-10744054)
chr5 (321-398)||(14318223-14318300)
chr5 (222-279)||(18633599-18633656)
chr5 (322-399)||(27916564-27916641)
chr5 (222-279)||(29172829-29172886)
chr5 (222-279)||(29875668-29875725)
chr5 (221-277)||(40029442-40029498)
chr5 (222-277)||(2217494-2217549)
chr5 (222-277)||(7075572-7075627)
chr5 (222-277)||(28863510-28863565)
chr5 (222-277)||(29692744-29692799)
chr5 (222-277)||(30800494-30800549)
chr5 (222-277)||(36578028-36578083)
chr5 (325-399)||(3850645-3850719)
chr5 (222-279)||(15635650-15635707)
chr5 (221-399)||(29366770-29366950)
chr5 (221-277)||(6912496-6912552)
chr5 (222-274)||(10743724-10743776)
chr5 (222-274)||(16038377-16038429)
chr5 (222-274)||(18046296-18046348)
chr5 (221-277)||(26133182-26133238)
chr5 (222-277)||(1105093-1105148)
chr5 (222-277)||(1381556-1381611)
chr5 (222-277)||(5917405-5917460)
chr5 (222-277)||(11799403-11799458)
chr5 (322-397)||(13990708-13990783)
chr5 (222-277)||(19565776-19565831)
chr5 (222-277)||(19685325-19685380)
chr5 (222-277)||(24443689-24443744)
chr5 (222-277)||(26133358-26133413)
chr5 (222-277)||(35928064-35928119)
chr5 (222-277)||(38170514-38170569)
chr5 (222-277)||(40167786-40167841)
chr5 (222-277)||(40764415-40764470)
chr5 (222-399)||(9179743-9179920)
chr5 (225-279)||(39379242-39379296)
chr5 (222-279)||(10409269-10409326)
chr5 (222-279)||(25561942-25561999)
chr5 (222-279)||(29151794-29151851)
chr5 (222-279)||(38496725-38496782)
chr5 (222-279)||(39379553-39379610)
chr5 (221-277)||(45137-45193)
chr5 (222-274)||(293828-293880)
chr5 (222-274)||(13990843-13990895)
chr5 (222-274)||(20660948-20661000)
chr5 (225-277)||(20985728-20985780)
chr5 (221-277)||(21050858-21050914)
chr5 (221-277)||(35928403-35928459)
chr5 (222-277)||(1104858-1104913)
chr5 (222-277)||(1381247-1381302)
chr5 (223-274)||(2636941-2636992)
chr5 (222-277)||(3850544-3850599)
chr5 (222-277)||(4203715-4203770)
chr5 (222-277)||(5917126-5917181)
chr5 (222-277)||(11799129-11799184)
chr5 (222-277)||(18046038-18046093)
chr5 (222-277)||(19565467-19565522)
chr5 (222-277)||(19685017-19685072)
chr5 (222-277)||(20986034-20986089)
chr5 (222-277)||(21124913-21124968)
chr5 (222-277)||(24443380-24443435)
chr5 (222-277)||(24781989-24782044)
chr5 (222-277)||(34125577-34125632)
chr5 (222-277)||(35876688-35876743)
chr5 (222-277)||(37271359-37271414)
chr5 (222-277)||(40167953-40168008)
chr5 (222-277)||(40764725-40764780)
chr5 (322-392)||(22551144-22551214)
chr5 (221-277)||(3850298-3850355)
chr5 (224-277)||(6912802-6912855)
chr5 (225-274)||(9532483-9532532)
chr5 (222-271)||(35166911-35166960)
chr5 (222-274)||(2032888-2032940)
chr5 (222-274)||(5614166-5614218)
chr5 (222-274)||(14318045-14318097)
chr5 (222-274)||(18258475-18258527)
chr5 (221-277)||(20661256-20661312)
chr5 (225-273)||(27916713-27916761)
chr5 (225-277)||(28108107-28108159)
chr5 (222-274)||(28213373-28213425)
chr5 (222-270)||(31037693-31037741)
chr5 (336-392)||(31602264-31602320)
chr5 (221-277)||(35609302-35609358)
chr5 (222-277)||(1286682-1286737)
chr5 (222-277)||(4736487-4736542)
chr5 (222-277)||(9179593-9179648)
chr5 (222-277)||(12144907-12144962)
chr5 (222-277)||(18258162-18258217)
chr5 (222-277)||(20683747-20683802)
chr5 (222-273)||(20690733-20690784)
chr5 (222-277)||(23381950-23382005)
chr5 (222-277)||(25779107-25779162)
chr5 (222-277)||(26071291-26071346)
chr5 (222-277)||(28871939-28871994)
chr5 (222-277)||(35876997-35877052)
chr5 (222-277)||(37271651-37271706)
chr5 (221-272)||(38962805-38962856)
chr5 (330-392)||(17070646-17070708)
chr5 (222-272)||(18286691-18286741)
chr5 (328-370)||(20690840-20690882)
chr5 (224-273)||(16616370-16616419)
chr5 (326-387)||(26071397-26071458)
chr5 (224-277)||(42207518-42207570)
chr5 (221-270)||(42994067-42994116)
chr5 (221-273)||(2636668-2636720)
chr5 (321-397)||(9532291-9532367)
chr5 (224-276)||(27850320-27850372)
chr5 (224-272)||(35609587-35609635)
chr5 (221-277)||(40038803-40038859)
chr5 (221-273)||(42553641-42553693)
chr5 (225-277)||(42596762-42596814)
chr5 (222-277)||(3851274-3851329)
chr5 (328-387)||(4736374-4736433)
chr5 (222-277)||(5904008-5904063)
chr5 (332-387)||(5904205-5904260)
chr5 (229-279)||(6118139-6118190)
chr5 (328-387)||(10830638-10830697)
chr5 (328-387)||(11935802-11935861)
chr5 (221-276)||(15916285-15916340)
chr5 (222-277)||(17070808-17070863)
chr5 (226-277)||(32888691-32888742)
chr5 (222-277)||(36973655-36973710)
chr5 (328-383)||(37271542-37271597)
chr5 (328-387)||(40038604-40038663)
chr5 (328-370)||(20661057-20661099)
chr5 (222-276)||(38555030-38555083)
chr5 (321-399)||(11799205-11799279)
chr5 (222-275)||(20416360-20416413)
chr5 (224-273)||(31037397-31037446)
chr5 (222-267)||(31602143-31602188)
chr5 (338-387)||(32108926-32108975)
chr5 (223-274)||(9588559-9588611)
chr5 (241-277)||(26071561-26071597)
chr5 (225-277)||(28871640-28871692)
chr5 (222-270)||(40038494-40038542)
chr5 (235-278)||(1105032-1105075)
chr5 (328-387)||(1286879-1286938)
chr5 (328-387)||(2636778-2636837)
chr5 (221-272)||(5103951-5104002)
chr5 (332-387)||(9588444-9588499)
chr5 (222-277)||(10830529-10830584)
chr5 (222-277)||(17070535-17070589)
chr5 (322-381)||(18286530-18286589)
chr5 (328-383)||(19685125-19685180)
chr5 (328-383)||(24443489-24443544)
chr5 (338-381)||(28107918-28107961)
chr5 (235-278)||(28213446-28213489)
chr5 (336-387)||(28213490-28213541)
chr5 (235-278)||(28871711-28871754)
chr5 (222-277)||(32108808-32108863)
chr5 (328-387)||(35609382-35609441)
chr5 (221-272)||(36973352-36973403)
chr5 (235-277)||(1286932-1286974)
chr5 (224-278)||(12145127-12145181)
chr5 (225-275)||(20417963-20418013)
chr5 (223-277)||(27916462-27916516)
chr5 (223-277)||(29855614-29855668)
chr5 (235-273)||(31602221-31602259)
chr5 (222-272)||(31602465-31602515)
chr5 (337-387)||(32888798-32888848)
chr5 (224-270)||(38452348-38452394)
chr5 (225-270)||(45456-45501)
chr5 (222-274)||(10830844-10830897)
chr5 (225-270)||(18286431-18286476)
chr5 (224-273)||(20691045-20691094)
chr5 (222-279)||(38496420-38496476)
chr5 (225-277)||(1286990-1287042)
chr5 (322-358)||(26133275-26133311)
chr5 (235-275)||(32888760-32888800)
chr5 (222-273)||(38554751-38554800)
[»] chr7 (232 HSPs)
chr7 (222-399)||(45073463-45073641)
chr7 (222-399)||(17999545-17999721)
chr7 (221-399)||(7431950-7432131)
chr7 (221-399)||(44508719-44508898)
chr7 (222-399)||(35015040-35015220)
chr7 (221-398)||(1007051-1007230)
chr7 (222-399)||(44344612-44344789)
chr7 (221-399)||(45021493-45021675)
chr7 (222-399)||(37372726-37372904)
chr7 (222-399)||(19783815-19783994)
chr7 (225-399)||(30352563-30352740)
chr7 (221-399)||(39719352-39719533)
chr7 (222-399)||(28911577-28911757)
chr7 (221-399)||(48358898-48359076)
chr7 (221-399)||(19561153-19561327)
chr7 (221-399)||(46304203-46304385)
chr7 (222-399)||(5308508-5308686)
chr7 (222-398)||(21554575-21554753)
chr7 (321-399)||(6108518-6108596)
chr7 (222-397)||(39832906-39833081)
chr7 (222-399)||(1559527-1559705)
chr7 (321-399)||(12894223-12894301)
chr7 (321-399)||(21223508-21223586)
chr7 (321-399)||(31732272-31732350)
chr7 (321-399)||(488814-488892)
chr7 (225-390)||(30709328-30709494)
chr7 (221-399)||(44403073-44403250)
chr7 (322-399)||(18022468-18022545)
chr7 (322-399)||(18311682-18311759)
chr7 (225-398)||(14738603-14738777)
chr7 (222-399)||(19757748-19757929)
chr7 (222-398)||(10358001-10358181)
chr7 (221-399)||(13769773-13769950)
chr7 (221-386)||(25547325-25547491)
chr7 (222-399)||(35210333-35210515)
chr7 (322-399)||(31310500-31310577)
chr7 (222-399)||(20388274-20388453)
chr7 (321-384)||(22871162-22871225)
chr7 (221-279)||(1006834-1006892)
chr7 (221-279)||(30352847-30352905)
chr7 (222-279)||(6108334-6108391)
chr7 (222-279)||(44508997-44509054)
chr7 (222-277)||(12894347-12894402)
chr7 (222-277)||(28911851-28911906)
chr7 (322-399)||(23816856-23816933)
chr7 (221-277)||(10358313-10358369)
chr7 (221-277)||(16853534-16853590)
chr7 (335-399)||(19465733-19465797)
chr7 (221-277)||(39833181-39833237)
chr7 (222-277)||(1559343-1559398)
chr7 (222-277)||(1614849-1614904)
chr7 (222-277)||(3975549-3975604)
chr7 (222-277)||(6509208-6509263)
chr7 (222-277)||(6509415-6509470)
chr7 (222-277)||(8144603-8144658)
chr7 (222-277)||(8555744-8555799)
chr7 (222-277)||(9659634-9659689)
chr7 (222-277)||(17999465-17999520)
chr7 (222-277)||(19561395-19561450)
chr7 (222-277)||(23399612-23399667)
chr7 (222-277)||(23676397-23676452)
chr7 (222-277)||(25988694-25988749)
chr7 (222-277)||(26878016-26878071)
chr7 (222-277)||(29198607-29198662)
chr7 (222-277)||(45228863-45228918)
chr7 (322-397)||(46648516-46648590)
chr7 (222-277)||(48192433-48192488)
chr7 (223-277)||(6079810-6079864)
chr7 (222-276)||(21223694-21223748)
chr7 (222-279)||(14738947-14739004)
chr7 (224-277)||(32189335-32189388)
chr7 (221-277)||(1974008-1974064)
chr7 (339-399)||(1974147-1974207)
chr7 (222-274)||(3975786-3975838)
chr7 (222-274)||(18022652-18022704)
chr7 (221-277)||(27037592-27037648)
chr7 (221-277)||(31732100-31732156)
chr7 (225-277)||(48192260-48192312)
chr7 (222-277)||(1614559-1614614)
chr7 (222-277)||(5233808-5233863)
chr7 (222-277)||(5354768-5354823)
chr7 (222-277)||(8144295-8144350)
chr7 (222-277)||(13770026-13770081)
chr7 (222-277)||(23399921-23399976)
chr7 (222-273)||(23816670-23816721)
chr7 (222-277)||(25092160-25092215)
chr7 (222-277)||(25092493-25092548)
chr7 (222-277)||(25988385-25988440)
chr7 (222-277)||(27458399-27458454)
chr7 (222-277)||(35104078-35104133)
chr7 (222-277)||(35104240-35104295)
chr7 (222-277)||(35665877-35665932)
chr7 (222-277)||(35838282-35838337)
chr7 (226-277)||(37372441-37372492)
chr7 (222-277)||(39719587-39719642)
chr7 (222-277)||(41054181-41054236)
chr7 (222-277)||(44402960-44403015)
chr7 (222-277)||(45073314-45073369)
chr7 (322-397)||(45671314-45671389)
chr7 (222-272)||(45021806-45021856)
chr7 (221-274)||(6589020-6589073)
chr7 (224-277)||(17854151-17854204)
chr7 (221-274)||(21554392-21554445)
chr7 (328-381)||(35665984-35666037)
chr7 (224-277)||(43058752-43058805)
chr7 (221-277)||(5308322-5308378)
chr7 (225-277)||(16940997-16941049)
chr7 (221-273)||(18927040-18927092)
chr7 (225-277)||(23676135-23676187)
chr7 (222-274)||(30223743-30223795)
chr7 (222-274)||(35837924-35837976)
chr7 (222-274)||(46304086-46304138)
chr7 (222-270)||(46648667-46648715)
chr7 (222-274)||(46759658-46759710)
chr7 (222-274)||(48852444-48852496)
chr7 (234-277)||(1271544-1271587)
chr7 (222-277)||(2945790-2945845)
chr7 (222-277)||(3807864-3807919)
chr7 (222-277)||(5234149-5234204)
chr7 (328-387)||(9659464-9659523)
chr7 (225-276)||(11766920-11766971)
chr7 (222-277)||(11767220-11767275)
chr7 (222-277)||(12932728-12932783)
chr7 (222-277)||(16940762-16940817)
chr7 (222-273)||(21223405-21223456)
chr7 (225-272)||(25547256-25547303)
chr7 (222-277)||(28262713-28262768)
chr7 (222-277)||(29198303-29198358)
chr7 (222-277)||(30223461-30223516)
chr7 (222-273)||(30709593-30709644)
chr7 (222-273)||(39438741-39438792)
chr7 (222-277)||(39438974-39439029)
chr7 (222-277)||(41053842-41053897)
chr7 (322-396)||(41365040-41365112)
chr7 (223-274)||(43300613-43300664)
chr7 (222-277)||(44568326-44568381)
chr7 (222-277)||(44568635-44568690)
chr7 (222-277)||(46759887-46759942)
chr7 (222-277)||(46828944-46828999)
chr7 (322-392)||(24953979-24954049)
chr7 (222-268)||(31310633-31310679)
chr7 (225-274)||(6589222-6589271)
chr7 (224-273)||(6847068-6847117)
chr7 (223-272)||(18022368-18022417)
chr7 (222-271)||(31732402-31732451)
chr7 (221-270)||(32189075-32189124)
chr7 (326-387)||(35104125-35104186)
chr7 (223-272)||(41365164-41365213)
chr7 (342-399)||(43300730-43300787)
chr7 (225-273)||(5355066-5355114)
chr7 (237-277)||(12894056-12894096)
chr7 (222-274)||(14543710-14543762)
chr7 (237-277)||(19758004-19758044)
chr7 (221-277)||(20388620-20388676)
chr7 (225-273)||(31503732-31503780)
chr7 (335-399)||(32189216-32189280)
chr7 (322-370)||(37952902-37952950)
chr7 (225-277)||(38186369-38186421)
chr7 (225-277)||(44841359-44841411)
chr7 (221-277)||(46829257-46829313)
chr7 (222-277)||(489017-489072)
chr7 (328-387)||(5354950-5355009)
chr7 (222-277)||(9659355-9659410)
chr7 (223-270)||(18311581-18311628)
chr7 (222-277)||(19465926-19465980)
chr7 (221-276)||(24717478-24717533)
chr7 (222-277)||(26877678-26877733)
chr7 (222-273)||(31310365-31310416)
chr7 (225-276)||(34877777-34877828)
chr7 (222-277)||(35470225-35470280)
chr7 (328-387)||(35838033-35838092)
chr7 (222-277)||(39520398-39520453)
chr7 (328-387)||(39520507-39520566)
chr7 (222-277)||(41364884-41364939)
chr7 (222-277)||(44958451-44958506)
chr7 (222-277)||(45228615-45228670)
chr7 (328-387)||(46759805-46759864)
chr7 (328-370)||(2945694-2945736)
chr7 (225-279)||(7432195-7432249)
chr7 (323-365)||(17854314-17854356)
chr7 (222-272)||(19005598-19005648)
chr7 (223-277)||(37527367-37527421)
chr7 (235-277)||(41054121-41054163)
chr7 (328-381)||(3975677-3975730)
chr7 (221-270)||(6911199-6911248)
chr7 (338-387)||(11767036-11767085)
chr7 (328-381)||(16940871-16940924)
chr7 (338-387)||(30223580-30223629)
chr7 (331-388)||(34877885-34877942)
chr7 (224-277)||(37952671-37952724)
chr7 (339-392)||(38186589-38186642)
chr7 (222-270)||(8555607-8555655)
chr7 (225-273)||(18891514-18891562)
chr7 (234-274)||(24953832-24953872)
chr7 (222-270)||(34878077-34878125)
chr7 (221-273)||(35469879-35469931)
chr7 (225-273)||(37953000-37953048)
chr7 (222-273)||(38186709-38186761)
chr7 (225-277)||(39520675-39520727)
chr7 (335-387)||(44841471-44841523)
chr7 (328-367)||(6892003-6892042)
chr7 (222-277)||(6892205-6892260)
chr7 (226-273)||(6954862-6954909)
chr7 (222-277)||(22539930-22539985)
chr7 (222-277)||(23816979-23817034)
chr7 (235-278)||(27458472-27458515)
chr7 (328-387)||(27458508-27458567)
chr7 (222-277)||(28528905-28528960)
chr7 (222-277)||(35210182-35210237)
chr7 (340-387)||(35470112-35470159)
chr7 (235-278)||(35470164-35470207)
chr7 (222-273)||(38486739-38486790)
chr7 (328-387)||(41054008-41054067)
chr7 (235-278)||(41054060-41054103)
chr7 (328-387)||(45228693-45228752)
chr7 (225-276)||(45671494-45671545)
chr7 (328-387)||(46829142-46829201)
chr7 (222-277)||(48854015-48854070)
chr7 (235-273)||(3808068-3808106)
chr7 (235-277)||(3975724-3975766)
chr7 (332-370)||(6846969-6847007)
chr7 (235-277)||(9659428-9659470)
chr7 (243-277)||(27458664-27458698)
chr7 (339-381)||(38486631-38486673)
chr7 (326-387)||(3808011-3808072)
chr7 (338-387)||(6589080-6589129)
chr7 (224-277)||(18926889-18926942)
chr7 (235-275)||(19005825-19005865)
chr7 (337-381)||(28262916-28262960)
chr7 (225-269)||(28529162-28529206)
chr7 (225-277)||(31503423-31503475)
chr7 (222-270)||(44344457-44344505)
[»] chr3 (294 HSPs)
chr3 (222-397)||(3151934-3152111)
chr3 (222-399)||(39436929-39437109)
chr3 (221-399)||(10976977-10977157)
chr3 (222-399)||(28427429-28427608)
chr3 (222-399)||(37506867-37507046)
chr3 (221-399)||(8510213-8510394)
chr3 (222-399)||(22155929-22156109)
chr3 (222-399)||(39288720-39288898)
chr3 (222-399)||(275444-275621)
chr3 (222-399)||(51834763-51834942)
chr3 (222-399)||(21159637-21159817)
chr3 (222-397)||(34238598-34238775)
chr3 (222-398)||(26799888-26800067)
chr3 (225-399)||(20757403-20757578)
chr3 (221-399)||(40169474-40169655)
chr3 (222-399)||(45320801-45320979)
chr3 (222-399)||(14633708-14633889)
chr3 (321-399)||(13584105-13584183)
chr3 (321-399)||(19656724-19656802)
chr3 (222-395)||(20612724-20612898)
chr3 (225-399)||(20907278-20907454)
chr3 (224-399)||(29955300-29955478)
chr3 (224-399)||(30004454-30004632)
chr3 (222-397)||(3830134-3830308)
chr3 (225-399)||(45161116-45161291)
chr3 (321-399)||(4950188-4950266)
chr3 (222-399)||(30130158-30130336)
chr3 (321-399)||(39072034-39072112)
chr3 (247-399)||(10778553-10778706)
chr3 (222-399)||(4513442-4513620)
chr3 (222-399)||(18175791-18175966)
chr3 (221-399)||(25710693-25710871)
chr3 (222-399)||(31869778-31869956)
chr3 (221-389)||(29445953-29446124)
chr3 (222-387)||(5345522-5345689)
chr3 (221-398)||(16123138-16123319)
chr3 (222-399)||(9863224-9863404)
chr3 (321-397)||(12673828-12673904)
chr3 (321-399)||(7518268-7518346)
chr3 (222-399)||(46186591-46186771)
chr3 (333-399)||(49670659-49670725)
chr3 (222-399)||(51500507-51500685)
chr3 (222-399)||(4814722-4814898)
chr3 (321-383)||(47901901-47901963)
chr3 (321-399)||(50261762-50261839)
chr3 (221-399)||(53701360-53701538)
chr3 (322-399)||(15016568-15016645)
chr3 (222-399)||(51759819-51759999)
chr3 (222-279)||(51834608-51834665)
chr3 (223-279)||(22156236-22156292)
chr3 (330-398)||(30426107-30426175)
chr3 (222-277)||(4513263-4513318)
chr3 (222-277)||(4950037-4950092)
chr3 (222-277)||(12673644-12673699)
chr3 (222-277)||(37507167-37507222)
chr3 (222-276)||(3151750-3151804)
chr3 (321-399)||(45521650-45521728)
chr3 (222-279)||(13584310-13584367)
chr3 (322-399)||(15286325-15286402)
chr3 (222-279)||(28942848-28942905)
chr3 (322-399)||(30552246-30552323)
chr3 (222-279)||(39436718-39436775)
chr3 (224-277)||(45006194-45006247)
chr3 (224-277)||(50196301-50196354)
chr3 (222-274)||(3830464-3830516)
chr3 (221-277)||(15016387-15016443)
chr3 (221-277)||(22008835-22008891)
chr3 (322-398)||(30268585-30268661)
chr3 (221-277)||(49323781-49323837)
chr3 (323-399)||(50196401-50196477)
chr3 (328-387)||(7957059-7957118)
chr3 (224-279)||(14633547-14633602)
chr3 (222-277)||(22008526-22008581)
chr3 (222-277)||(22016044-22016099)
chr3 (222-277)||(25615975-25616030)
chr3 (222-277)||(28552328-28552383)
chr3 (222-277)||(30268505-30268560)
chr3 (222-277)||(31480136-31480191)
chr3 (339-398)||(40979479-40979538)
chr3 (222-277)||(51550082-51550137)
chr3 (222-277)||(53701608-53701663)
chr3 (222-277)||(54608518-54608573)
chr3 (222-369)||(28942525-28942674)
chr3 (224-274)||(43440735-43440785)
chr3 (222-275)||(9262102-9262155)
chr3 (222-279)||(10977284-10977341)
chr3 (222-279)||(20611020-20611077)
chr3 (222-279)||(28427245-28427302)
chr3 (222-279)||(39288573-39288630)
chr3 (222-275)||(40370536-40370589)
chr3 (342-399)||(43440614-43440671)
chr3 (223-279)||(3361761-3361817)
chr3 (221-277)||(4034716-4034772)
chr3 (225-277)||(8940470-8940522)
chr3 (221-277)||(9261788-9261844)
chr3 (221-277)||(15979337-15979393)
chr3 (221-277)||(26089729-26089785)
chr3 (221-277)||(26090023-26090079)
chr3 (221-277)||(31480445-31480501)
chr3 (221-277)||(44802281-44802337)
chr3 (221-392)||(45313690-45313864)
chr3 (222-274)||(46751271-46751323)
chr3 (221-277)||(47902090-47902146)
chr3 (222-277)||(474044-474099)
chr3 (222-277)||(1721397-1721452)
chr3 (222-273)||(7588318-7588369)
chr3 (222-277)||(12740907-12740962)
chr3 (222-277)||(12741216-12741271)
chr3 (222-277)||(19844526-19844581)
chr3 (222-277)||(28552021-28552076)
chr3 (222-277)||(29678024-29678079)
chr3 (222-277)||(29955611-29955666)
chr3 (222-277)||(30004766-30004821)
chr3 (222-277)||(30106165-30106220)
chr3 (222-277)||(30552423-30552478)
chr3 (222-277)||(32119220-32119275)
chr3 (222-277)||(32119529-32119584)
chr3 (328-387)||(40277931-40277990)
chr3 (222-277)||(43441548-43441603)
chr3 (222-277)||(45002021-45002076)
chr3 (222-277)||(45002330-45002385)
chr3 (222-277)||(47336228-47336283)
chr3 (222-277)||(47336526-47336581)
chr3 (222-277)||(48924185-48924240)
chr3 (221-279)||(49670745-49670804)
chr3 (222-277)||(50196602-50196657)
chr3 (222-277)||(51550391-51550446)
chr3 (222-277)||(54608808-54608863)
chr3 (222-276)||(9603629-9603683)
chr3 (223-277)||(11463233-11463287)
chr3 (222-275)||(14772211-14772264)
chr3 (222-279)||(34238858-34238915)
chr3 (222-279)||(40169344-40169401)
chr3 (222-274)||(3387552-3387604)
chr3 (221-277)||(4034998-4035054)
chr3 (225-277)||(4322134-4322186)
chr3 (222-270)||(4814540-4814588)
chr3 (222-274)||(7518090-7518142)
chr3 (221-277)||(7957171-7957227)
chr3 (222-274)||(19656541-19656593)
chr3 (221-277)||(20644504-20644560)
chr3 (222-274)||(21159453-21159505)
chr3 (222-274)||(29446154-29446206)
chr3 (222-274)||(29525105-29525157)
chr3 (225-277)||(35569081-35569133)
chr3 (221-277)||(39072158-39072214)
chr3 (221-277)||(43441269-43441325)
chr3 (222-274)||(47005467-47005519)
chr3 (223-271)||(51760069-51760117)
chr3 (222-274)||(52342531-52342583)
chr3 (222-277)||(474353-474408)
chr3 (328-387)||(4034826-4034885)
chr3 (228-279)||(8510472-8510523)
chr3 (328-387)||(9261986-9262045)
chr3 (222-277)||(9597040-9597095)
chr3 (225-276)||(9863050-9863100)
chr3 (222-273)||(15286156-15286207)
chr3 (222-277)||(15979646-15979701)
chr3 (222-277)||(21553889-21553944)
chr3 (223-274)||(25610078-25610129)
chr3 (222-277)||(25710510-25710565)
chr3 (222-277)||(28452321-28452376)
chr3 (222-273)||(29490692-29490743)
chr3 (222-277)||(35565508-35565563)
chr3 (222-277)||(40545564-40545619)
chr3 (222-277)||(40979655-40979710)
chr3 (223-274)||(46186410-46186461)
chr3 (222-277)||(47005154-47005209)
chr3 (223-277)||(9596759-9596813)
chr3 (221-275)||(30426174-30426227)
chr3 (328-370)||(36673072-36673114)
chr3 (222-276)||(43440495-43440549)
chr3 (322-396)||(46901203-46901276)
chr3 (338-387)||(30034304-30034353)
chr3 (224-277)||(31869596-31869649)
chr3 (225-277)||(3387268-3387320)
chr3 (224-272)||(7518396-7518444)
chr3 (222-270)||(9603871-9603919)
chr3 (221-277)||(19844264-19844320)
chr3 (222-274)||(30130452-30130504)
chr3 (225-277)||(49324091-49324143)
chr3 (221-273)||(50261885-50261937)
chr3 (222-270)||(52342195-52342243)
chr3 (328-380)||(52342421-52342473)
chr3 (221-272)||(275783-275834)
chr3 (336-387)||(2486734-2486785)
chr3 (328-387)||(8555140-8555199)
chr3 (328-387)||(9596927-9596986)
chr3 (332-387)||(20405055-20405110)
chr3 (222-277)||(27681627-27681682)
chr3 (222-273)||(29686819-29686870)
chr3 (222-277)||(30034417-30034472)
chr3 (222-277)||(30128284-30128339)
chr3 (222-273)||(30424628-30424679)
chr3 (331-382)||(36732750-36732801)
chr3 (222-277)||(40277822-40277877)
chr3 (222-277)||(46622074-46622129)
chr3 (222-273)||(47114487-47114538)
chr3 (222-273)||(51500398-51500449)
chr3 (332-387)||(53113496-53113551)
chr3 (224-270)||(2486854-2486900)
chr3 (222-264)||(25353199-25353241)
chr3 (222-272)||(35177255-35177305)
chr3 (335-381)||(35533393-35533439)
chr3 (222-272)||(46901104-46901154)
chr3 (225-275)||(47901803-47901853)
chr3 (328-370)||(50009029-50009071)
chr3 (225-274)||(8555256-8555305)
chr3 (328-381)||(9603738-9603791)
chr3 (224-277)||(14772470-14772523)
chr3 (224-273)||(16679678-16679727)
chr3 (326-387)||(16679796-16679857)
chr3 (331-380)||(28418653-28418702)
chr3 (338-387)||(35177374-35177423)
chr3 (338-387)||(35565627-35565676)
chr3 (225-277)||(863597-863649)
chr3 (225-277)||(1721092-1721144)
chr3 (224-272)||(2486581-2486629)
chr3 (225-277)||(8940163-8940215)
chr3 (225-277)||(10778373-10778425)
chr3 (222-274)||(13514525-13514577)
chr3 (330-390)||(14772323-14772383)
chr3 (222-274)||(28452147-28452199)
chr3 (331-387)||(35407551-35407607)
chr3 (222-274)||(38232241-38232293)
chr3 (221-277)||(40370284-40370340)
chr3 (225-277)||(40545784-40545836)
chr3 (225-273)||(40723121-40723169)
chr3 (225-277)||(45005889-45005941)
chr3 (243-274)||(590197-590228)
chr3 (328-387)||(1721196-1721255)
chr3 (235-278)||(3387338-3387381)
chr3 (225-272)||(12673931-12673978)
chr3 (328-383)||(12741016-12741071)
chr3 (222-277)||(20405168-20405223)
chr3 (328-387)||(20644614-20644673)
chr3 (222-277)||(20644821-20644876)
chr3 (222-273)||(20757724-20757775)
chr3 (328-383)||(22008726-22008781)
chr3 (328-383)||(22016244-22016299)
chr3 (222-277)||(25609767-25609822)
chr3 (328-387)||(25609963-25610022)
chr3 (234-277)||(25610016-25610059)
chr3 (221-276)||(29678333-29678388)
chr3 (222-277)||(29686544-29686599)
chr3 (222-277)||(35407735-35407790)
chr3 (222-277)||(35498416-35498471)
chr3 (235-278)||(35565581-35565624)
chr3 (235-278)||(39132791-39132834)
chr3 (328-383)||(45002130-45002185)
chr3 (235-278)||(45005959-45006002)
chr3 (328-387)||(45005995-45006054)
chr3 (332-387)||(47114646-47114701)
chr3 (222-277)||(50009229-50009284)
chr3 (221-272)||(52956382-52956433)
chr3 (235-278)||(52956584-52956627)
chr3 (222-269)||(53113443-53113490)
chr3 (235-277)||(4034790-4034832)
chr3 (235-277)||(7957112-7957154)
chr3 (235-277)||(9262039-9262081)
chr3 (223-273)||(11463430-11463480)
chr3 (234-272)||(16123452-16123489)
chr3 (222-260)||(26273786-26273824)
chr3 (223-277)||(28418845-28418899)
chr3 (224-270)||(30034109-30034155)
chr3 (328-382)||(31480337-31480391)
chr3 (329-387)||(38232440-38232498)
chr3 (222-272)||(39071862-39071912)
chr3 (225-279)||(49670477-49670531)
chr3 (235-277)||(52342467-52342509)
chr3 (332-382)||(54767284-54767334)
chr3 (338-383)||(8940361-8940406)
chr3 (338-387)||(11463313-11463362)
chr3 (224-273)||(19297898-19297947)
chr3 (241-278)||(20644584-20644621)
chr3 (225-274)||(20807800-20807849)
chr3 (235-276)||(28452262-28452303)
chr3 (336-369)||(29678237-29678270)
chr3 (240-277)||(33794751-33794788)
chr3 (222-275)||(35936780-35936833)
chr3 (223-272)||(36673195-36673244)
chr3 (328-381)||(39132745-39132798)
chr3 (342-387)||(40370420-40370465)
chr3 (235-276)||(40370474-40370515)
chr3 (240-277)||(40560492-40560529)
chr3 (222-254)||(26800137-26800169)
chr3 (328-364)||(27681426-27681462)
chr3 (225-273)||(36672966-36673014)
chr3 (225-277)||(45521781-45521833)
chr3 (339-383)||(49323982-49324026)
chr3 (225-277)||(51058593-51058645)
chr3 (333-381)||(51058703-51058751)
chr3 (332-392)||(53719154-53719214)
chr3 (225-277)||(54767472-54767524)
[»] scaffold0373 (1 HSPs)
scaffold0373 (222-399)||(8547-8727)
[»] scaffold0811 (2 HSPs)
scaffold0811 (222-399)||(1464-1644)
scaffold0811 (222-279)||(1311-1368)
[»] scaffold0021 (2 HSPs)
scaffold0021 (222-399)||(12182-12362)
scaffold0021 (221-274)||(12484-12537)
[»] scaffold0051 (2 HSPs)
scaffold0051 (222-399)||(5527-5708)
scaffold0051 (222-279)||(5399-5456)
[»] scaffold0210 (2 HSPs)
scaffold0210 (222-399)||(14697-14875)
scaffold0210 (222-277)||(14957-15012)
[»] scaffold0535 (2 HSPs)
scaffold0535 (222-398)||(8850-9028)
scaffold0535 (224-277)||(8734-8787)
[»] scaffold0003 (2 HSPs)
scaffold0003 (222-399)||(366097-366273)
scaffold0003 (222-277)||(365979-366034)
[»] scaffold0712 (1 HSPs)
scaffold0712 (222-392)||(5209-5382)
[»] scaffold0709 (1 HSPs)
scaffold0709 (222-392)||(5229-5402)
[»] scaffold0347 (2 HSPs)
scaffold0347 (221-399)||(4134-4313)
scaffold0347 (229-277)||(4016-4064)
[»] scaffold0016 (2 HSPs)
scaffold0016 (222-399)||(10168-10335)
scaffold0016 (222-277)||(10460-10515)
[»] scaffold0179 (1 HSPs)
scaffold0179 (222-399)||(3113-3291)
[»] scaffold0123 (2 HSPs)
scaffold0123 (321-399)||(17864-17942)
scaffold0123 (222-277)||(17988-18043)
[»] scaffold1001 (1 HSPs)
scaffold1001 (222-399)||(2778-2955)
[»] scaffold0159 (2 HSPs)
scaffold0159 (321-388)||(35103-35170)
scaffold0159 (221-279)||(34930-34988)
[»] scaffold0002 (2 HSPs)
scaffold0002 (222-399)||(94057-94237)
scaffold0002 (223-270)||(94282-94329)
[»] scaffold0065 (2 HSPs)
scaffold0065 (222-399)||(3741-3918)
scaffold0065 (221-274)||(3531-3584)
[»] scaffold0166 (2 HSPs)
scaffold0166 (222-397)||(24482-24657)
scaffold0166 (222-277)||(24372-24427)
[»] scaffold0060 (3 HSPs)
scaffold0060 (321-399)||(8432-8510)
scaffold0060 (222-274)||(8330-8382)
scaffold0060 (222-274)||(8590-8642)
[»] scaffold0056 (5 HSPs)
scaffold0056 (222-277)||(54815-54870)
scaffold0056 (225-277)||(50023-50075)
scaffold0056 (225-277)||(55124-55176)
scaffold0056 (328-383)||(49914-49969)
scaffold0056 (328-383)||(55015-55070)
[»] scaffold0026 (3 HSPs)
scaffold0026 (222-277)||(82651-82706)
scaffold0026 (222-277)||(82341-82396)
scaffold0026 (328-387)||(82450-82509)
[»] scaffold0024 (2 HSPs)
scaffold0024 (222-277)||(75709-75764)
scaffold0024 (222-277)||(75359-75414)
[»] scaffold0337 (1 HSPs)
scaffold0337 (221-274)||(12524-12577)
[»] scaffold0326 (6 HSPs)
scaffold0326 (222-279)||(4041-4098)
scaffold0326 (222-279)||(19223-19280)
scaffold0326 (222-279)||(4231-4288)
scaffold0326 (222-279)||(19413-19470)
scaffold0326 (330-377)||(4128-4175)
scaffold0326 (330-377)||(19310-19357)
[»] scaffold0105 (2 HSPs)
scaffold0105 (221-277)||(17911-17967)
scaffold0105 (322-392)||(17791-17863)
[»] scaffold0339 (1 HSPs)
scaffold0339 (221-272)||(3405-3456)
[»] scaffold0160 (2 HSPs)
scaffold0160 (222-277)||(27309-27364)
scaffold0160 (235-277)||(27072-27114)
[»] scaffold0005 (5 HSPs)
scaffold0005 (222-277)||(47925-47980)
scaffold0005 (225-273)||(48180-48228)
scaffold0005 (326-358)||(47972-48004)
scaffold0005 (222-274)||(223120-223172)
scaffold0005 (235-276)||(222884-222925)
[»] scaffold0001 (2 HSPs)
scaffold0001 (222-277)||(148227-148282)
scaffold0001 (339-382)||(148007-148050)
[»] scaffold0684 (3 HSPs)
scaffold0684 (222-276)||(2606-2660)
scaffold0684 (336-387)||(2412-2463)
scaffold0684 (222-270)||(2334-2382)
[»] scaffold0176 (3 HSPs)
scaffold0176 (222-274)||(22003-22055)
scaffold0176 (336-387)||(21807-21858)
scaffold0176 (235-276)||(21763-21804)
[»] scaffold0119 (2 HSPs)
scaffold0119 (221-277)||(16723-16779)
scaffold0119 (328-387)||(16832-16891)
[»] scaffold0011 (3 HSPs)
scaffold0011 (222-270)||(189630-189678)
scaffold0011 (222-272)||(189329-189379)
scaffold0011 (328-367)||(189437-189476)
[»] scaffold0078 (2 HSPs)
scaffold0078 (222-277)||(3752-3807)
scaffold0078 (222-273)||(4028-4079)
[»] scaffold0007 (3 HSPs)
scaffold0007 (221-276)||(2829-2884)
scaffold0007 (222-276)||(2501-2555)
scaffold0007 (332-381)||(2615-2664)
[»] scaffold0085 (1 HSPs)
scaffold0085 (222-277)||(35029-35084)
[»] scaffold0008 (1 HSPs)
scaffold0008 (222-270)||(44158-44206)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 221)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 38980253 - 38980074
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
38980253 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 38980154  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38980153 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 38980074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38731829 - 38732006
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||                 
38731829 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 38731928  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
38731929 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 38732006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 37272102 - 37271923
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
37272102 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 37272003  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37272002 tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 37271923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 26814229 - 26814049
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           |||||||| ||||||||||||              
26814229 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaattttttgttt 26814130  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26814129 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 26814049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19183782 - 19183962
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||           ||||||||| |||||||||||              
19183782 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaattttttgttt 19183881  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19183882 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 19183962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 23989838 - 23990015
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  ||||||||||||||||||||||||||||||||||||||| ||           |||||||||||||||||||||            |    
23989838 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcactataaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 23989937  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23989938 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 23990015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33732862 - 33733038
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |        ||||||||| |||||||||||            |    
33732862 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttgatccctgcaaaattttttgtttttg 33732960  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
33732961 aaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 33733038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 43789192 - 43789012
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||           |||||||||||||||||||||              
43789192 ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 43789093  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||    
43789092 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaattttgtagtttttgg 43789012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 223 - 399
Target Start/End: Complemental strand, 3838263 - 3838084
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||| |||||||||||||||||||||| |||||||||||||||||||||             |||||||||||||||||||||               
3838263 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgtttt 3838164  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3838163 tgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 3838084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 7814737 - 7814561
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  |||||||||||||||||||||||| ||||||||||||||||||          |||||||||||||| ||||||            |    
7814737 ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtcaaaaaaaattgtttttggtccccgcaaaattttttgtttttg 7814638  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
7814637 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttg 7814561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 17541776 - 17541598
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||| ||||          |||||||||||||||||||||               
17541776 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 17541677  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17541676 ttaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 17541598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 40301975 - 40302155
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||             |||||||||||||||||||||              
40301975 ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttgttt 40302074  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
40302075 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaattttgtagtttttgg 40302155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 44985623 - 44985800
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||| |||||||            |    
44985623 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaatttgtttttggtccatgcaaaaatttttgtttttg 44985722  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||    
44985723 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaattttgtagtttttgg 44985800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 20658061 - 20658238
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| || |||||||||||||||||||||||| |||||||||||||||||||          |||||||| ||||||||||||            |    
20658061 ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaattgtttttagtccctgcaaaattttttgtttttg 20658160  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
20658161 aaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 20658238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 24483401 - 24483577
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||||| | |||||||| |||||||||||||||||||||||||||||||||          |||||||||||||||||||||             |    
24483401 gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttaa 24483500  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
24483501 aaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaattttgtagtttttgg 24483577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 43710384 - 43710558
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    ||||||||| ||||||||||| |||||||| |||||||||||||||||||||            ||||||||||||||||||||            ||||    
43710384 taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccctataaaaaaaaaatgtttttggtccctgcaaaattttttgtttttgaaa 43710483  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
43710484 atagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttgg 43710558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 44073807 - 44073627
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||           |||||||||||||||||||||              
44073807 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 44073708  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| ||||||||||| ||||||||||    
44073707 ttgaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttgg 44073627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26707873 - 26708050
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||| ||||||||||||| | |||||||||||||||||||||          |||||||||||||||||||||            |    
26707873 ggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaatttgttgtttttg 26707972  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||  ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||    
26707973 aaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttgg 26708050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 388
Target Start/End: Complemental strand, 5790900 - 5790730
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |          |||||||||||||||||||||              
5790900 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaattgtttttggtccctgcaaaaaaattttgtt 5790801  T
319 nn-gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
       ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5790800 tttgaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 5790730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 240 - 399
Target Start/End: Complemental strand, 22881950 - 22881791
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgacccc 339  Q
    ||||||||||||||| ||||||||||||||||||||||          |||||||||||||||||||||            ||||||||||||| |||||    
22881950 gtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctaacccc 22881851  T
340 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
22881850 acttttgtgatgatttgcatacgtgtcacattataactaaaccaattttgtagtttttgg 22881791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 11713845 - 11713665
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||              
11713845 ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttgttt 11713746  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||    
11713745 ttgaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaattttgtagtttttgg 11713665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 24483632 - 24483710
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24483632 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 24483710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 43597499 - 43597322
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  ||||||||||||| |||||| ||||||||||||||||||||||          |||||||||||||||||||||            |    
43597499 ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 43597400  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||    
43597399 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg 43597322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8046329 - 8046508
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgttttt--ggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||          || |||||  | |||||||| ||               
8046329 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttttttttttgatccctgcagaattttttgtttt 8046428  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
8046429 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 8046508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 26238816 - 26238991
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| ||||||||||||||||||||| ||||||||| ||||||||||||          |||| |||||||||||||||             ||||    
26238816 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaattgtgtttggtccctgcaaatttttttgtttttgaaa 26238915  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa-ttttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
26238916 atagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttttgtagtttttgg 26238991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 41694004 - 41693823
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||             ||||||||||||| || ||||             
41694004 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaagaaaaaaattgtttttggtccatgtaaaattttttgtt 41693905  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||    
41693904 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaattttttagtttttgg 41693823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16899996 - 16900074
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
16899996 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttgg 16900074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16993387 - 16993465
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
16993387 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaattttgtagtttttgg 16993465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 41791020 - 41791197
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||            |||||||||||| ||||||||            |    
41791020 ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg 41791119  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||||||    
41791120 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaattaattttgtagtttttgg 41791197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 7814505 - 7814428
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
7814505 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaattttgtagtttttg 7814428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 225 - 397
Target Start/End: Original strand, 17912452 - 17912627
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    ||||||||  |||||||||||||||||||| |||||||||||||||||| |||||          |||||||||||||||||||||            ||    
17912452 taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga 17912551  T
323 aaatagtccctgaccccacttttgtgat-gatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||||||||||||||||||||| || ||||||||| | ||||||||||||||||||||||||||||||||    
17912552 aaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaattttgtagttttt 17912627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10664984 - 10665162
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| | ||||||||||           ||||||||||||| |||||||                
10664984 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt 10665083  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||    
10665084 gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaattttgtagtttttgg 10665162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14393029 - 14392951
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||    
14393029 gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaactaattttgtagtttttgg 14392951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 31225715 - 31225894
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||             ||||||||| ||||||||||               
31225715 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaaaaaaaatattttgtttttgatccctgcaaatttttttgttt 31225814  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||    
31225815 ttgaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaattttgtagtttttgg 31225894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 40786561 - 40786639
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
40786561 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 40786639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 224 - 399
Target Start/End: Complemental strand, 1497943 - 1497765
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||| |||||| ||| |||||||||||||||||||||||||||||||||          ||   |||||||||||||||||||                
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttgttttt 1497844  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||   ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||    
1497843 gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttttagtttttgg 1497765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 221 - 388
Target Start/End: Original strand, 12835324 - 12835494
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||||  |||||||||||||||||||||||| ||||||||||||||||||             |||||||||||| ||||||||             
12835324 tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattttgtt 12835423  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
       |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
12835424 tttgaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaatttt 12835494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 25954423 - 25954247
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| |||||||||| |||||||||||||||||||| ||||||||||||             |||||||||||||||||||||            |    
25954423 taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaataaaaattttgtttttggtccctgcaaaa-tttttgtttttg 25954325  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
25954324 aaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaattttgtagtttttgg 25954247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 10375070 - 10374898
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||           ||||||||||||||||||||                
10375070 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg--taaaaaaaatgtttttggtccctgcaaaatttgttgttttt 10374973  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggc-acattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||     ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
10374972 gaaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaattttgtagtttttgg 10374898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29865511 - 29865333
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||          || |||||||||||||||||||                
29865511 ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaatttgtttttggtccctgcaaaattttttgttttt 29865412  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| || |||  ||||||||||||||||||||||||| |||||||  |||||||||||||| ||||||||||    
29865411 gaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaattttatagtttttgg 29865333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 43592046 - 43592224
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||             ||||||||||||| |||||||              
43592046 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaataatttgtttttggtccttgcaaaattttgttttt 43592145  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||| ||||||||||||||||||||||||||||| || | ||||||  |||||||||||||||    
43592146 --gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccgttttgtagtttttgg 43592224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 45442415 - 45442492
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||| || |||||||| ||||||||||||||||    
45442415 aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 45442492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 31326252 - 31326073
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||             |||||||||||||||||||||              
31326252 ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaattttttgttt 31326153  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||  || ||||||||||||||||    
31326152 tttaaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacatgatgactg-gcccattttgtagtttttgg 31326073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 32691413 - 32691491
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||    
32691413 gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttgg 32691491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 16900206 - 16900149
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
16900206 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 16900149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 16993597 - 16993540
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
16993597 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 16993540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19184151 - 19184094
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
19184151 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 19184094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 37271739 - 37271796
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
37271739 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 37271796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24483891 - 24483836
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
24483891 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 24483836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 5790557 - 5790615
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||    
5790557 tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt 5790615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 19831694 - 19831616
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||    
19831694 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttgg 19831616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 26813865 - 26813923
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
26813865 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 26813923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 7814246 - 7814303
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||    
7814246 ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt 7814303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 17541382 - 17541439
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
17541382 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 17541439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36622250 - 36622425
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||         |||||||||||||||||||                  
36622250 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaatgtttttggtccctgcaaatttttttatttttt 36622348  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||| |||||||||||||||||||| || ||||| || || ||||| ||||| ||||||||||    
36622349 aaaatagtccatgaccccatttttgtgatgatttgcatac-tgccacatgatgacggaaccgattttatagtttttgg 36622425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 43788858 - 43788915
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
43788858 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt 43788915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 3671193 - 3671137
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
3671193 tggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 3671137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5334750 - 5334806
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
5334750 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 5335041 - 5334985
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
5335041 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 8046649 - 8046593
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
8046649 tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 8046593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 11713484 - 11713540
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
11713484 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 11713540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20131682 - 20131626
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
20131682 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20131626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 22881613 - 22881665
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22881613 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 22881665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42358702 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 42358754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2481557 - 2481502
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
2481557 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2481502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3837933 - 3837988
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||    
3837933 ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg 3837988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4423895 - 4423950
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
4423895 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 4423950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9195206 - 9195151
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
9195206 ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg 9195151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11788416 - 11788361
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
11788416 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 11788361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14003742 - 14003687
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
14003742 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 14003687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15842823 - 15842768
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
15842823 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16522991 - 16523046
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
16522991 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16523046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16523325 - 16523270
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
16523325 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16523270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24358616 - 24358671
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
24358616 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24358671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25705449 - 25705394
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
25705449 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25705394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29859872 - 29859817
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29859872 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 33733242 - 33733187
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||    
33733242 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct 33733187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40302339 - 40302284
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
40302339 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 40302284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43597154 - 43597209
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
43597154 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 43597209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 10374829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 27311069 - 27311015
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||    
27311069 ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct 27311015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 29865276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 146328 - 146381
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
146328 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 146381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 38639412 - 38639469
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||    
38639412 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt 38639469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1497609 - 1497665
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||    
1497609 tggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg 1497665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 9195053 - 9195109
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
9195053 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 9195109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 10671941 - 10671889
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
10671941 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 10671889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
15842464 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29859490 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 34317797 - 34317853
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
34317797 tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 34317853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3671003 - 3671058
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||    
3671003 ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg 3671058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4424185 - 4424130
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
4424185 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4424130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10665294 - 10665239
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||    
10665294 ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg 10665239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13215060 - 13215115
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13215060 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13215115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14003409 - 14003464
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
14003409 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 14003464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16673771 - 16673716
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
16673771 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg 16673716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18113089 - 18113144
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||    
18113089 ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg 18113144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20131317 - 20131372
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
20131317 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20131372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24358945 - 24358890
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
24358945 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24358890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25705085 - 25705140
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
25705085 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25705140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26239160 - 26239105
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
26239160 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 26239105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 27109072 - 27109127
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||    
27109072 tggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct 27109127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27310876 - 27310930
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
27310876 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg 27310930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30215422 - 30215477
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
30215422 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 30215477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31226077 - 31226022
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||    
31226077 ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg 31226022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
33576117 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33576062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41451837 - 41451892
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
41451837 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 41451892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41693674 - 41693729
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||  |||||||||||||||||||||    
41693674 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 41693729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 42695867 - 42695922
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||    
42695867 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct 42695922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44559062 - 44559117
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
44559062 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 44559117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44985984 - 44985929
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||    
44985984 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 44985929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 17912808 - 17912754
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| |||||||| ||||||||||||||||||||||||||||||| |||||    
17912808 taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggt 17912754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
20939324 gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20939270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||| |||||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 1138036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 146691 - 146635
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||  |||||||||||||||||||||    
146691 tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 146635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 4042610 - 4042662
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||  ||||||||||||||||||||||||||||||||||    
4042610 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc 4042662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||||||||| ||||||||||| |||||||||||||||||||    
16968555 taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg 16968607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31325919 - 31325975
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||    
31325919 tggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg 31325975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||    
36622582 ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 36622534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 36806897 - 36806841
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
36806897 tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 36806841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40124965 - 40125021
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||| ||||||||||||| ||||    
40124965 tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg 40125021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 41791313 - 41791261
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| ||||    
41791313 tggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc 41791261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 322 - 398
Target Start/End: Complemental strand, 44993957 - 44993881
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || || ||||  |||| ||||||||||    
44993957 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgaccgaactcatttcgtagtttttg 44993881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2265397 - 2265342
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  ||||||||| |||||||||| ||||||||||||||||||||||    
2265397 ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg 2265342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 4794185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10671630 - 10671685
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||  ||||||||||||||||||||||    
10671630 ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 10671685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16673411 - 16673466
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
16673411 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 16673466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17302143 - 17302088
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||||||||||| ||||||||||||||||||||||    
17302143 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 17302088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 20939216 - 20939157
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||||||| || ||||||||||| || |||||||| ||||    
20939216 gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 20939157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 23732220 - 23732161
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
23732220 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 23732161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 31644841 - 31644892
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
31644841 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 31644892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32476095 - 32476150
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||| ||||||||||||||||||    
32476095 ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg 32476150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32691313 - 32691368
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||  ||||||||||||||||||||||||||| ||||||    
32691313 ggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg 32691368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33575752 - 33575807
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
33575752 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 33575807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37911120 - 37911065
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||| ||||||    
37911120 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg 37911065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 38979888 - 38979947
Alignment:
221 tggctaaaatatagttttagtccctgcaaatat-gcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||   ||||||||||||||||||||||||    
38979888 tggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt 38979947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40786460 - 40786515
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| || ||||||||||| ||||||||||||||||||||||    
40786460 ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg 40786515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| |||||  ||||||||||||||||||||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc 42696151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43710708 - 43710653
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||||| || |||||||||||||||||||||||||||||||||    
43710708 ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg 43710653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
228 aatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 35155344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||| ||||||||||||||||||||||||| ||||||||||| || |||||||    
1138091 gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 1138144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 4042891 - 4042838
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||  ||||||||||||||| |||||||||||||||||||    
4042891 tggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc 4042838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||| |||||||||||||||||||||||||| ||||||||||| || |||||||    
25750857 gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 25750804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 34318084 - 34318031
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||| |||||| |||||||||||||||||| |||||||||    
34318084 tggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc 34318031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 44559358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 3172020 - 3172072
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||| ||||||||||||||||||| |||||||||||||||    
3172020 ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc 3172072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3172532 - 3172480
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||| |||| ||||||||||||||||||||||||||||||    
3172532 ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc 3172480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 18113455 - 18113399
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||| ||||||||| |||||||||||||| ||||||    
18113455 tggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg 18113399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| |||||||||| |||||||||| ||||||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 23990145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 25954115 - 25954167
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  ||||||||||||||||||||  ||||||||||||||||||    
25954115 ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc 25954167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34964160 - 34964104
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| |||||||| ||||||| |||||    
34964160 tggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg 34964104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 45442696 - 45442644
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  ||||||||| |||||||||| |||||||||||||||||||    
45442696 ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc 45442644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1138359 - 1138304
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| |||||||| |||||||||||||    
1138359 ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg 1138304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2481193 - 2481248
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || | |||||||||| ||||||||||||||||||||||    
2481193 ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg 2481248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4424004 - 4424063
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
4424004 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4424063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4842940 - 4842999
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| |||||||||||||||||| || ||||||||||| || |||||||| ||||    
4842940 gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacccattt 4842999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13850522 - 13850577
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||  || ||||||||||| |||| |||||||||||||||||    
13850522 ggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctg 13850577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16523098 - 16523157
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
16523098 gtccctggcgccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16523157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 270
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||||||||||||||||||||||||||    
16900135 ttttagtccctgcaaatatgcctcgttttggtttta 16900100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 270
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||||||||||||||||||||||||||    
16993526 ttttagtccctgcaaatatgcctcgttttggtttta 16993491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23732328 - 23732274
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| |||||||||||||||||||||| |||||||||||    
23732328 ggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg 23732274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 27109151 - 27109210
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
27109151 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 27109210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30215871 - 30215816
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||  | ||||||||||||||||||||    
30215871 ggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg 30215816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 31909370 - 31909311
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
31909370 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 31909311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 31909478 - 31909428
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||    
31909478 ggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc 31909428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36815835 - 36815780
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| |||||||||| ||||||||||||||||| ||||    
36815835 ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg 36815780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 37228733 - 37228784
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| |||||||||||||||  |||||||||||||||||    
37228733 ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc 37228784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40125075 - 40125134
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40125075 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40125134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40125289 - 40125234
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||| |||| |||||||||||||    
40125289 ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg 40125234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43671934 - 43671989
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| |||||||| |||||||||||||||| ||||    
43671934 ggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg 43671989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 43672041 - 43672100
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||| ||||||| ||||||||||| || |||||||| ||||    
43672041 gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacccattt 43672100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 44994061 - 44994010
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||| |||||||||||||| |||||||| |||||||||    
44994061 ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc 44994010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 268
Target Start/End: Original strand, 29831814 - 29831860
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt 268  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||    
29831814 ggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt 29831860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #174
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||| ||||| |  |||||||||||| |||||||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct 4842918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #175
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 23732038 - 23732091
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||||  ||||  |||||||||||||| |||||||||||||||||||    
23732038 tggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc 23732091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 381
Target Start/End: Complemental strand, 1295437 - 1295385
Alignment:
329 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||||||| ||||||||||||||||||||| | ||||||||| || |||||||    
1295437 tccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaac 1295385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| |||||||||||||||  |||||||||||||||||    
3832634 taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc 3832586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| || ||||||||||||| |||||||||||||||||    
13850881 taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc 13850833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 14393128 - 14393077
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| | |||||| |||||||||||| |||||||||||||||||||    
14393128 ggctaaaatat-gatttagttcctgcaaatatgtctcgttttggttttagtcc 14393077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 278
Target Start/End: Complemental strand, 33576074 - 33576030
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||||| ||| |||||||||| ||||||||    
33576074 gttttagtccctgcaaatatgtctcattttggttttggtccctgg 33576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 45442316 - 45442364
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||| |||||    
45442316 ggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 2481302 - 2481357
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
2481302 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 2481357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 3832388 - 3832439
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
3832388 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 3832439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 4042781 - 4042722
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||  |||||||||||||||||||| ||||| ||||| || |||||||| ||||    
4042781 gtccctgacttcacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 4042722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4423968 - 4424011
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
4423968 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 4424011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4794203 - 4794246
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
4794203 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 4794246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10671739 - 10671798
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
10671739 gtccctggctccacttttctgatgatttgcacacgtggcacatgatgactgaacccattt 10671798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| | ||| ||||||||||||||| ||||||||||||||    
13215365 ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt 13215318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 16523062 - 16523105
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||||||| |||||| ||||||||    
16523062 ttttggtccctgcaaatatgcctcgtttaggttttggtccctgg 16523105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 20658409 - 20658362
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| |||||| |||||||||||||| ||||||||| ||||    
20658409 ggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt 20658362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 242 - 277
Target Start/End: Complemental strand, 26708184 - 26708149
Alignment:
242 ccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||    
26708184 ccctgcaaatacgcctcgttttggttttagtccctg 26708149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 26709696 - 26709747
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  ||||||| |||||||||||| ||||||||||| ||||||    
26709696 ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc 26709747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 34317915 - 34317966
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
34317915 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 34317966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35155619 - 35155564
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||| || |||||| ||||||||||||    
35155619 ggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg 35155564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Complemental strand, 35686224 - 35686173
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| |||| |||||| || |||||||| ||||    
35686224 ccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 35686173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37910756 - 37910811
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||| |||||||||||||| |||| |||||||||||||    
37910756 ggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg 37910811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #197
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 37911011 - 37910952
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| | |||||| || || |||||||| ||||    
37911011 gtccctgactccacttttgtgatgatttgcacatgtggcatatgatgactgaacccattt 37910952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #198
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 41451946 - 41452001
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
41451946 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 41452001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #199
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43672318 - 43672263
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| |||||||||||||||  | |||||||||||||||||||    
43672318 ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg 43672263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 1696230 - 1696284
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||||||| |||||||||||||||||  | ||||||||||| || ||||||||    
1696230 gtccctgacctcacttttgtgatgatttaaacacgtggcacatgatgactgaacc 1696284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||| ||||| |||||| |||||||| ||||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagtc 4794422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 333 - 387
Target Start/End: Complemental strand, 13215311 - 13215257
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||| |||||||||||| | ||||||||| || |||||||| ||||    
13215311 tgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacccattt 13215257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||||| ||||||||||||||||||||| ||||| |||||    
29182277 gtccctgactccacttttgtgatgatttgcacacgtgacacat 29182319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    |||| ||||||||||||||||||||||||||||||    
29831885 ttttggtccctgcaaatatgcctcgttttggtttt 29831919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 358
Target Start/End: Original strand, 37228831 - 37228861
Alignment:
328 gtccctgaccccacttttgtgatgatttgca 358  Q
    |||||||||||||||||||||||||||||||    
37228831 gtccctgaccccacttttgtgatgatttgca 37228861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 38732120 - 38732078
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||| ||||||||||||||| ||||||    
38732120 ttttagtcccagcaaatatggctcgttttggttttaatccctg 38732078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 387
Target Start/End: Complemental strand, 44559299 - 44559241
Alignment:
329 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||| |||||||| |||||||||||| ||||| ||||| || |||||||| ||||    
44559299 tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacccattt 44559241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 334 - 387
Target Start/End: Original strand, 13850635 - 13850688
Alignment:
334 gaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||| ||||| ||||| || | |||||| ||||    
13850635 gaccccacttttgtgatgatttgcacacgtgacacatgatgattgaacccattt 13850688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||  |||| ||||||||||||||| ||||||||  ||||||||||||    
25299747 ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg 25299800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 263
Target Start/End: Complemental strand, 32691635 - 32691594
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgtttt 263  Q
    |||||||| || ||||||||||||||||||||| ||||||||    
32691635 ggctaaaacatggttttagtccctgcaaatatgtctcgtttt 32691594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||| |||||| |||||||||| ||||||||||||||| ||||||    
44993806 ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg 44993858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||| ||||||||||||||| |||||||||||||| |||||    
1138055 ttttggtccctgcaaatatgtctcgttttggttttggtccc 1138095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 1295544 - 1295492
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||  | ||||||||||||  |||||||||||||||||||||    
1295544 taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg 1295492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 387
Target Start/End: Complemental strand, 5164376 - 5164328
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||| ||||| ||||| || |||||||| ||||    
5164376 cacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt 5164328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 13802486 - 13802534
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| |||||||| | || |||||| ||||||||||||||||    
13802486 ggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta 13802534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||||||  ||||||||||  |||||||||||||||| ||||    
19831511 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg 19831563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #217
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||  ||||  |||||||||||||| |||||||||||||||||    
29182440 ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt 29182392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #218
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 35155405 - 35155465
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||| ||||||||||| | ||| ||||| || |||||||  |||||||||    
35155405 ctgaccccacttttgggatgatttgcacatgtgccacatgatgactgaactcattttgtag 35155465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #219
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 38231430 - 38231486
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  ||||  ||||||||||||| ||| |||||| ||||||||||||    
38231430 tggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctg 38231486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #220
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 380
Target Start/End: Original strand, 38231544 - 38231592
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||||||||||||| ||||||| | ||||||||| || ||||||    
38231544 ctgaccccacttttgtgataatttgcacatgtggcacatgatgactgaa 38231592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #221
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 43592380 - 43592328
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  ||||||||||||| |||||| ||| ||||| |||||||||    
43592380 ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc 43592328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 260)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18473272 - 18473451
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
18473272 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 18473371  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18473372 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 18473451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 32729049 - 32728870
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
32729049 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 32728950  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32728949 tgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 32728870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 7001898 - 7001717
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||             
7001898 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgtt 7001799  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
7001798 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg 7001717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14007489 - 14007666
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||          |||||||||||||||||||||            |    
14007489 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaatttttagtttttg 14007588  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||    
14007589 aaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaatcaattttgtagtttttgg 14007666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 395
Target Start/End: Complemental strand, 41358663 - 41358488
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||          |||||||||||||||||||||               
41358663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggttt 41358564  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 395  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41358563 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 41358488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 31258339 - 31258519
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
31258339 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaattttttgttt 31258438  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
31258439 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 31258519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 3679626 - 3679803
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||          |||||| |||||| |||||||            |    
3679626 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttctggtccttgcaaaaatttttgtttttg 3679725  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
3679726 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 3679803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 12361011 - 12361190
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||            |||||||| ||||||||||||               
12361011 ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagtttgtttttcgtccctgcaaaattttttgttta 12361110  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12361111 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 12361190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 48956067 - 48955886
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||             |||||||||||||||||||||             
48956067 tggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtt 48955968  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48955967 tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 48955886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19622655 - 19622835
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||           |||||||||||||||||||||              
19622655 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 19622754  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
19622755 ttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 19622835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26061956 - 26062136
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           || ||||||||||||||||||              
26061956 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaattttttgttt 26062055  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
26062056 ttgaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaatcaattttgtagtttttgg 26062136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22919684 - 22919861
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||| |||||||            |    
22919684 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccttgcaaaattttttgtttttg 22919783  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
22919784 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 22919861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 45290457 - 45290636
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||          |||||||||||||| ||||||               
45290457 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtcccagcaaaattttttgtttt 45290556  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
45290557 ttaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 45290636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 35308112 - 35307931
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||| |||||             
35308112 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaattttttgtt 35308013  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
35308012 tttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 35307931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 41881093 - 41881273
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||           || ||||||||||||||||||              
41881093 ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaaatttttgttt 41881192  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
41881193 ttgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttgg 41881273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 13259988 - 13260165
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||          ||||||||| |||||| ||||            |    
13259988 ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaaaaaaaaattgtttttgttccctgtaaaattttttgtttatg 13260087  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
13260088 aaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 13260165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 24649349 - 24649529
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||            |||||||||| ||||||||||              
24649349 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctgaaaaaaaaaaatttgtttttggcccctgcaaaattttttgttt 24649448  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24649449 tttaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 24649529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 29688428 - 29688254
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||  |        |||||||||||||||||||||                 
29688428 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct--taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 29688331  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
29688330 aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccatttttttagtttttg 29688254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 389
Target Start/End: Original strand, 990088 - 990256
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||           ||||||||||||||||||||               
990088 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa--tttttgttt 990185  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 389  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
990186 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 990256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 221 - 389
Target Start/End: Complemental strand, 44641433 - 44641266
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||| ||||                
44641433 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgtaaaattttttgttttt 44641334  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 389  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
44641333 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 44641266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33379888 - 33380066
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||  |         |||||||||||||||||||||                
33379888 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 33379987  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||| || || ||||||||||||||||||||||    
33379988 taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaattttgtagtttttgg 33380066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 21383104 - 21383281
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  ||||||||||||| |||||| ||||||||||||||||||||||           ||||||||||||||||||||            |    
21383104 ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaataaaatgtttttggtccctgcaaaattttttgtttttg 21383203  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||    
21383204 aaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 21383281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 32454294 - 32454111
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn------ttgtttttggtccctgcaaaannnnnnn 315  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||                |||||||||||||||||||||           
32454294 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 32454195  T
316 nnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
         ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
32454194 tttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 32454111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 21391371 - 21391199
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| ||||||||||||| |||||||||||||||| ||||||||| ||| |        |||||||||||| ||||||||            ||||    
21391371 taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctg-tgaaaaaaattgtttttggtctctgcaaaaatttttgtttttgaaa 21391273  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
21391272 atagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 21391199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 4323829 - 4324008
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||| ||||||||||||||||||||||||||||||| |||||||| |||             |||||||| ||||||||||||               
4323829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaattttttgtttt 4323928  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||    
4323929 tgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttatagtttttgg 4324008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 26191358 - 26191537
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||           ||||||||||||| |||||||               
26191358 tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttt 26191457  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
26191458 tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 26191537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 2733285 - 2733363
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
2733285 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 2733363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 13770489 - 13770666
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||| |||||||               
13770489 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt 13770588  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
     |||||||||||||||||||| ||||||||||||||||||||||||||||| |  |||||||| ||||||||||||||    
13770589 tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgacgactgaacccattttgtagttttt 13770666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 390
Target Start/End: Complemental strand, 15335292 - 15335124
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||| ||||             |||||||||||||||||||||            |    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttgtttttg 15335193  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 390  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
15335192 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 15335124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 32626792 - 32626714
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||    
32626792 gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaattttgtagtttttgg 32626714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 18302281 - 18302204
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18302281 aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 18302204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 18900130 - 18899956
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    |||||||| ||||||||||||||||||||| ||||||||||||||||||||||           |||||||||||||||||||||             ||    
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaaattgtttttggtccctgcaaaattttttgttttt-aa 18900032  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
18900031 aatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 18899956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 10552212 - 10552134
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
10552212 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg 10552134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17984595 - 17984517
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
17984595 gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 17984517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 1159739 - 1159662
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||    
1159739 gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaattttgtagtttttg 1159662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 11822004 - 11822181
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||           ||||||||||||| |||||||                
11822004 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt 11822103  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||| ||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| |||||||||||||||    
11822104 gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttg 11822181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 326 - 399
Target Start/End: Original strand, 35005491 - 35005564
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35005491 tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 35005564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 52254183 - 52254360
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||          ||||||||||||||||||||                  
52254183 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctgcaaatttttttatttttt 52254282  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| |||| | |||||||||||||||||||||| || |||||||| ||||||||||||||||    
52254283 aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 52254360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 50429209 - 50429031
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||            ||||||||||| |||||||||               
50429209 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggttcctgcaaaattttttgtttt 50429110  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||  ||||||||||||||    
50429109 tgaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaaccagctttgtagtttttgg 50429031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 26442899 - 26442721
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||             |||||||||||||||||| ||              
26442899 ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcacaattttttgttt 26442800  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||  || ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||    
26442799 ttgaaaatagtccc--acaccacttttgtgatgatttgcatatgtgacacattataactgaaccaattttgtagtttttgg 26442721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 7819103 - 7818923
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||| || |||||||||||||||||||||||||||||| |||             |||||||||||||||||||||              
7819103 ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 7819004  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||  | | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
7819003 ttgaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtttttgg 7818923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 34383047 - 34383125
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||  |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
34383047 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttgg 34383125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 3753214 - 3753390
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||        |||||||||||||||||||||             |    
3753214 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaattgtttttggtccctgcaaaattttttgtttttta 3753312  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttgg 399  Q
    |||| |||| |||||||| ||||||||||||||||||||||||  ||| || |||||| ||| |||||||||||||||    
3753313 aaatggtccttgaccccatttttgtgatgatttgcatacgtggtgcatgatgactgaacccatttttgtagtttttgg 3753390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 4360370 - 4360447
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||    
4360370 aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaattttatagtttttgg 4360447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29072497 - 29072677
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||              
29072497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 29072596  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||||||||| ||||||||||||| ||||||||||||||  || |||| ||| |||||||| |||||||    
29072597 tttaaaatagtccctgaccccatttttgtgatgattcgcatacgtggcacaagatgactggacccattttgtaatttttgg 29072677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 34808200 - 34808373
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| |||||||||||| |||||||| |||||||||||||||||||||| |         |||||||||||||||||||              |||    
34808200 taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg-taaaaaaaaatgtttttggtccctgcaaatttttttgttttttaaa 34808298  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||  |||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
34808299 atagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacccattttgtagtttttgg 34808373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 16083154 - 16083231
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
16083154 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 16083231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 46868329 - 46868406
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||    
46868329 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg 46868406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 1811170 - 1811092
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| ||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||    
1811170 gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg 1811092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 20756120 - 20756198
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||| | ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||    
20756120 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg 20756198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 33067629 - 33067559
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||| |||||||||    
33067629 aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtag 33067559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 49226361 - 49226415
Alignment:
345 tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49226361 tgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 49226415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 990379 - 990322
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
990379 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 990322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 41358369 - 41358426
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41358369 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41358426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 224 - 397
Target Start/End: Complemental strand, 45368847 - 45368674
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    |||||||||  |||||||| ||||||||||||||||||||||||||||||||||          || ||||||||||||||||||             ||    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattatttttggtccctgcaaaaattttcgttttttaa 45368748  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    ||||||||||||||||| ||||||||||||||||||| ||| ||||  || |||||||  ||||||||||||||    
45368747 aatagtccctgaccccatttttgtgatgatttgcatatgtgtcacacgatgactgaactgattttgtagttttt 45368674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 48609493 - 48609416
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||    
48609493 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccattttgtagtttttgg 48609416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1810927 - 1810982
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
1810927 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 1810982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18302387 - 18302332
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
18302387 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18302332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45368490 - 45368545
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
45368490 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 45368545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 18473595 - 18473541
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
18473595 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 18473541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 323 - 397
Target Start/End: Complemental strand, 22953454 - 22953380
Alignment:
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||||| ||| |||||||||||||||| |||||||| || ||||||||| |||||||||||||||||||    
22953454 aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaattttgtagttttt 22953380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
7818783 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 7818832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19623017 - 19622960
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
19623017 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt 19622960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 37545850 - 37545773
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| ||||||| ||||||||| ||||||||||||| ||||| || |||||||| ||||||||||||||||    
37545850 aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacccattttgtagtttttgg 37545773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44641079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 44641132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 45290820 - 45290763
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
45290820 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 45290763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24653801 - 24653857
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
24653801 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24653857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 29072863 - 29072807
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||    
29072863 tggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg 29072807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 35005744 - 35005692
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
35005744 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 35005692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 37545627 - 37545683
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
37545627 tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg 37545683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 38151213 - 38151157
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
38151213 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38151157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 52254480 - 52254424
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||    
52254480 tggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 52254424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3753572 - 3753517
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||    
3753572 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 3753517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6567496 - 6567441
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
6567496 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 6567441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13260321 - 13260266
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
13260321 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13260266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21391096 - 21391151
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
21391096 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 21391151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24507843 - 24507788
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
24507843 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24507788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26142420 - 26142591
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||||||||| || | |||||||||||||||||||||||||||| |||            |||||||| ||||||||||||               
26142420 ggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgtaaaaaaaaaatttgttttttgtccctgcaaaattttttgtttt 26142519  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||| ||||||||    
26142520 tgaaaatagtccctgaccccacttttgtgatgatttgc--------cacattataactgaaccaattttgttgtttttgg 26142591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33045690 - 33045635
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
33045690 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 33045635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||    
35005444 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 35005499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35307715 - 35307770
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
35307715 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 35307770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 38164295 - 38164240
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
38164295 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38164240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47819232 - 47819287
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
47819232 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47819596 - 47819541
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
47819596 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 50799130 - 50799185
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
50799130 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 50799185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt 31258645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 44157750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 26191735 - 26191682
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
26191735 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 26191682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 46868578 - 46868521
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||    
46868578 tggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg 46868521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
3247559 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3247507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 3679987 - 3679931
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||    
3679987 tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg 3679931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 10631163 - 10631219
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
10631163 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10631219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 16060886 - 16060830
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
16060886 tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16060830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 17984702 - 17984650
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||    
17984702 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 17984650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24507478 - 24507534
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
24507478 tggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 24977777 - 24977833
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
24977777 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 24977833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
26442563 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 26442615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 27521676 - 27521755
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac--tgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| | || ||||||||||||||||||||||||||||| || ||  |||||| ||||||||||||||||    
27521676 aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacatgatgacagtgaacccattttgtagtttttgg 27521755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35056529 - 35056585
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35056529 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35056585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 38136982 - 38136926
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
38136982 tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 38136926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
38163934 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38163986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40718109 - 40718165
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
40718109 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 40718165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 45380637 - 45380581
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
45380637 tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 45380581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 45638579 - 45638635
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
45638579 tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 45638635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 48730509 - 48730445
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || |||||||| |||||||||    
48730509 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattttgtag 48730445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3247198 - 3247253
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
3247198 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3247253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8140434 - 8140489
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
8140434 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8140489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8140799 - 8140744
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||||||||||||||||||||||||||||||||||    
8140799 ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg 8140744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10631528 - 10631473
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
10631528 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 10631473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11822365 - 11822310
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
11822365 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg 11822310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||    
12158690 ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg 12158745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12360968 - 12360913
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
12360968 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12360913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 15516582 - 15516637
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||    
15516582 ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg 15516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15526362 - 15526307
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
15526362 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 15526307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 16026938 - 16026883
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
16026938 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16026883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 17984333 - 17984384
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||| |||||||||||||||||||||||||||||||||||    
17984333 ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc 17984384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19720712 - 19720767
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
19720712 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19720767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 226 - 277
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| |||||||||| |||||||||||||||||||||||||||||||||    
24649656 aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 24649605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26324585 - 26324640
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
26324585 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 26324640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30322929 - 30322984
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
30322929 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 30322984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30323293 - 30323238
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
30323293 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 30323238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32626529 - 32626584
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
32626529 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 32626584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
33000305 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 33000360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33000669 - 33000614
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
33000669 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33000614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33234546 - 33234601
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
33234546 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 33234601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34002940 - 34002885
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| || |||||||||||||||||||    
34002940 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 34002885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35056894 - 35056839
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
35056894 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 35056839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39747835 - 39747780
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
39747835 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 39747780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45380272 - 45380327
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
45380272 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45380327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 48609236 - 48609291
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||    
48609236 ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg 48609291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 48609594 - 48609543
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||    
48609594 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc 48609543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 48955714 - 48955765
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||    
48955714 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc 48955765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||| |||||| |||||||||||||||||||||||||||||||||||||    
2939934 aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 2939984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 10887598 - 10887544
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||    
10887598 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct 10887544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 16026573 - 16026627
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| |||| |||||||||||||| ||||||||||||||||||||||    
16026573 ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct 16026627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 271
Target Start/End: Complemental strand, 22953557 - 22953507
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag 271  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||    
22953557 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag 22953507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
27521577 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 27521631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| |||||||||||||||| |||| ||||||||||||||||||||||    
39303675 gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg 39303729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 44158042 - 44157988
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||    
44158042 ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct 44157988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4789363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 39303874 - 39303817
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||| || |||||| | ||||||||||||||||    
39303874 ttttgtgatgatttgcatacgtggcacatgatgactgaatccattttgtagtttttgg 39303817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 12322971 - 12322915
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||||    
12322971 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg 12322915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 18079516 - 18079572
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||| |||||||||    
18079516 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattttgtag 18079572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
18899842 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 18899894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 19721019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 22919977 - 22919925
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||| |||||||||||||||||||| ||||||||||    
22919977 ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc 22919925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31060786 - 31060842
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| || |||||||||||||||||||    
31060786 tggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 31060842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 33234913 - 33234857
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||    
33234913 tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg 33234857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 37624746 - 37624798
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||| |||||||||||||||||||||||||||||||| ||||    
37624746 ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc 37624798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
38150851 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 38150903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 41738795 - 41738851
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||| |||| |||||||||||||    
41738795 tggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg 41738851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7867129 - 7867184
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| |||||||| |||||||||||||    
7867129 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg 7867184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8364916 - 8364861
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| ||||| ||||||||| |||||||||||||| |||||||    
8364916 ggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg 8364861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10887233 - 10887288
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||  |||||||||||||||||||||    
10887233 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 10887288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc 15058470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 18927890 - 18927945
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||| || ||||||||||| || |||||||||||||    
18927890 ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt 18927945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 19198836 - 19198781
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||| ||||| ||||    
19198836 ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacccattt 19198781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21383428 - 21383373
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||| ||| |||||||||||||| ||||| ||||||||||||    
21383428 ggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg 21383373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 24510051 - 24510110
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| | ||||||||| || |||||||| ||||    
24510051 gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt 24510110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24654167 - 24654112
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||| |||||    
24654167 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg 24654112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24978122 - 24978067
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| ||||  ||||||||||||||||||||||||||| ||||    
24978122 ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg 24978067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 26324947 - 26324896
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  ||||||||| |||||||||||||||||||||||||||||    
26324947 ggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc 26324896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 33045355 - 33045410
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| | ||||| |||||||||||||||||| |||||||||||||||||||    
33045355 ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg 33045410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 39025382 - 39025328
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||    
39025382 tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct 39025328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||| ||||| |||||||||||||||| |||||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc 46183737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 234 - 276
Target Start/End: Original strand, 292871 - 292913
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
292871 gttttagtccctgcaaatatgcctcgttttgcttttagtccct 292913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 264
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttg 264  Q
    ||||||||||| |||||||||||||||||||||||||||||||    
18079660 ggctaaaatatggttttagtccctgcaaatatgcctcgttttg 18079618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||| |||||||||| ||||||||||||||||||||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 32420153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| ||||||||||||||||||||| ||| |||||||||||||||    
7350426 taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc 7350475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || |||||||    
8364867 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac 8364814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||  | |||||||||||||||||||||||||||||||||||    
17129691 ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg 17129744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| |||| |||||||||| ||||||||||||||||||||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 26207333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 41739120 - 41739068
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||   |||||||||||||||||||||    
41739120 ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg 41739068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||| ||||||||||||||||| ||||||||||||    
5058989 taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg 5058937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 15211859 - 15211803
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||| |||||||||||||||||||||||| | ||||||    
15211859 tggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg 15211803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20948754 - 20948810
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||| |||||||| ||||||| ||||||||||||||    
20948754 tggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg 20948810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 25658013 - 25658069
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||| ||||||||| ||||||||||||||| ||||||    
25658013 tggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg 25658069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 33067348 - 33067400
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||| |||||||||| |||||||||||||| ||||    
33067348 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc 33067400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40718475 - 40718419
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||| | |||||| ||||||||||||    
40718475 tggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg 40718419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 45638894 - 45638846
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||    
45638894 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 45638846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4360626 - 4360571
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||  |||||||| |||||    
4360626 ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg 4360571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4789417 - 4789476
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||  | ||||||||||| || |||||||| ||||    
4789417 gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacccattt 4789476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 7867357 - 7867302
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||  ||||||||||||||||||    
7867357 ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg 7867302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10887342 - 10887401
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
10887342 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 10887401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 12322718 - 12322773
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||| |||||||||||| | ||||||||| |||| |||||||||||    
12322718 ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaattt 12322773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12360603 - 12360658
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| |||| ||||||| |||||    
12360603 ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg 12360658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 12360712 - 12360771
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| | ||||||||| || | |||||| ||||    
12360712 gtccctgaccccacttttgtgatgatttgcacatgtggcacataatgagtgaacccattt 12360771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 14007875 - 14007824
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||||| || | |||||||||||||||| |||||||||    
14007875 ggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtc 14007824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 15211511 - 15211562
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||    
15211511 ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc 15211562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 16060596 - 16060646
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| |||||| |||||||||||||||||||||||||||    
16060596 ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc 16060646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16060704 - 16060763
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
16060704 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 16060763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 16083047 - 16083098
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||||||||| ||||||||| |||||||| |||||||||    
16083047 ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc 16083098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 17129975 - 17129916
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| |||||||| || || |||||||| ||||    
17129975 gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacccattt 17129916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18079398 - 18079453
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  ||||| |||| |||||||||||||| ||||||||||||||||||    
18079398 ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg 18079453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28507458 - 28507403
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| |||| |||||||||||||    
28507458 ggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg 28507403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31061151 - 31061096
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||  ||||||||||||||||||||||    
31061151 ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg 31061096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||| |||||||||| |||||||||| |||||||||||||||    
33067729 gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta 33067682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 42482979 - 42483030
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||    
42482979 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc 42483030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 50428873 - 50428928
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| ||||||||| ||||| ||||||    
50428873 ggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg 50428928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 15058766 - 15058716
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| |||||  |||||||||||||| |||||||||||||||||    
15058766 ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt 15058716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #201
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 16083394 - 16083348
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||| |||||||||||||||||||| |||||||||| ||||||||    
16083394 aaatatggttttagtccctgcaaatatacctcgttttgattttagtc 16083348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #202
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||| ||||| ||||||||||||||| |||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #203
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 277
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
239 agtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||| ||||||||||||||||||||||    
18302070 agtccctgcaaatatgtctcgttttggttttagtccctg 18302108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||||||||||| |||||||||| ||| |||||| ||||||||    
22953258 ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc 22953308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| ||||||||||||| ||||||| ||| ||||||||||||| ||||||    
26062255 taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt 26062201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 33380258 - 33380204
Alignment:
221 tggctaaaatatagttttagtccc-tgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||||| ||| | ||||||||||||||||||||||||||||    
33380258 tggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc 33380204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||| |||||||||||||||||||| ||||| |||||||||||||    
34382948 gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtc 34382997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 383
Target Start/End: Complemental strand, 42483217 - 42483167
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    |||||||||||||||||||||||||| ||||| ||||| || |||||||||    
42483217 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca 42483167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||| ||||| |||| ||||||||||||||||||| ||||||||||    
48730615 ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc 48730565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 49073691 - 49073745
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| |||| |||||||||| ||||||||||||||| |||||    
49073691 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct 49073745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||||||||||||||||||||||||||| ||||| |||||    
49073944 gtccctgaccccacttttgtgatgatttgcacacgtgtcacat 49073902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| ||||| ||| |||||||||| ||||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc 7350684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 24977898 - 24977947
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
24977898 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24977947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 25658299 - 25658246
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||  ||||  |||||||||||||||||||||||| ||||||||||||    
25658299 ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg 25658246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 330 - 367
Target Start/End: Original strand, 32420208 - 32420245
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggca 367  Q
    ||||||||||||||||||||||||||||| ||||||||    
32420208 ccctgaccccacttttgtgatgatttgcacacgtggca 32420245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 1159840 - 1159784
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  ||||||| | ||||||| ||||| |||||||||||||||||||    
1159840 tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg 1159784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 19720965 - 19720913
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||| ||||||||||||| ||||||| ||||||||||| || ||||||    
19720965 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaa 19720913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 387
Target Start/End: Original strand, 34002691 - 34002743
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||| |||||||| ||||||||||| || ||||| |||||||    
34002691 accccacttttgtgacgatttgcacacgtggcacatgatgactgagccaattt 34002743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 46184051 - 46183999
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||| ||||||| ||||||| ||| |||||||||| |||||||    
46184051 taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctg 46183999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #220
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 321 - 364
Target Start/End: Original strand, 292959 - 293002
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg 364  Q
    ||||||||||| |  |||||||||||||||||||||||||||||    
292959 gaaaatagtccatagccccacttttgtgatgatttgcatacgtg 293002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #221
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4565336 - 4565281
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||| | ||||||||||||||| ||||||||  ||||||||||||    
4565336 ggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg 4565281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #222
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 7350663 - 7350620
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| |||||||||||||||||||||||||||||| ||| ||||    
7350663 ttttggtccctgcaaatatgcctcgttttggttttggtctctgg 7350620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 10631419 - 10631364
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
10631419 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 10631364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 10887306 - 10887349
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
10887306 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 10887349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 15466249 - 15466300
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||||||||| ||  ||||||| ||||    
15466249 ccccacttttgtgatgatttgcacacgtggcacatgatgtctgaacccattt 15466300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 16026829 - 16026774
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
16026829 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 16026774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #227
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 22674203 - 22674254
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||  |||| |||||||||| ||||||||||||||||||    
22674203 ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc 22674254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #228
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 24510309 - 24510258
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| |||||||||||||||  ||||||| ||||||||    
24510309 tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt 24510258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 379
Target Start/End: Complemental strand, 26324838 - 26324787
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 379  Q
    ||||||||||||||||||||||||||||||| || || ||||| || |||||    
26324838 gtccctgaccccacttttgtgatgatttgcacacatgtcacataatgactga 26324787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 33000560 - 33000505
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
33000560 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 33000505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 38150957 - 38151012
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
38150957 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 38151012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 39747474 - 39747528
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| |||||||| | ||||||||||||||||||||||    
39747474 ggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg 39747528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 41738913 - 41738964
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||| |||||||||| ||||||||||| || |||||||| ||||    
41738913 ccccacttttgtaatgatttgcacacgtggcacatgatgactgaacctattt 41738964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 42483271 - 42483224
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| ||||| |||||||||||||||| | |||||||||||    
42483271 ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt 42483224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 46183757 - 46183800
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
46183757 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 46183800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 46868226 - 46868277
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||| |||  ||||||||||||||||||||| || ||||||||||||||    
46868226 ggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtc 46868277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 49923818 - 49923763
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||| |||||||||||| |||||||| ||||||||||||    
49923818 ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg 49923763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 5058838 - 5058888
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||||||||||| |||||||||||| | ||||||||| || ||||||||    
5058838 ctgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacc 5058888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| |||||  || ||||||||||||||| ||||| ||||||||||||    
19198948 gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg 19198894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #240
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
26324874 ttttggtccctgcaaatatgtctcgttttggttttcgtccctg 26324832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #241
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    |||| ||||||||||||||||||||||||||||||    
28507188 ttttggtccctgcaaatatgcctcgttttggtttt 28507222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #242
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 36912853 - 36912895
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttg 264  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||    
36912853 ggctaaaatatggttttggtccctgcaaatatgtctcgttttg 36912895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #243
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 37625026 - 37624976
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||| ||||||||||||| |||||||  ||||||||||| |||||    
37625026 gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc 37624976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12322603 - 12322656
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||  ||||||||||||||  |||||||| |||||||||    
12322603 tggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc 12322656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttg 264  Q
    |||||||||| |||||| |||||||||||||||||| |||||    
26142671 gctaaaatatggttttaatccctgcaaatatgcctcattttg 26142630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| |||| |||||||||||||| ||||  ||||||||||||    
29579322 ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg 29579375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 33045475 - 33045524
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || | |||||| ||||    
33045475 ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 33045524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 37624802 - 37624859
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||| ||||||||||||||||||| ||||||||||| || | |||| | |||||||||    
37624802 accctacttttgtgatgatttgcacacgtggcacatcatgaatgaatccattttgtag 37624859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 37646760 - 37646797
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||| |||||||| ||||||||||||    
37646760 gtccctgcaaatatgcttcgttttgattttagtccctg 37646797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| ||||| ||||||||||||||| ||||||||| |||| ||||    
39025112 taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc 39025161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 39747592 - 39747641
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
39747592 ccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 39747641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 44157923 - 44157874
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || | |||||| ||||    
44157923 ccacttttgtgatgatttgcacacgtggcacatgatgagtgaacccattt 44157874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 46183812 - 46183857
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||| ||||||||||| || |||||||| ||||    
46183812 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 46183857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 47038866 - 47038923
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||  |||||||||||||||||||  || |||| |||||| |||||||||    
47038866 ggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggt 47038923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #255
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| |||||  ||||||||||||||  |||||||||||||||||    
8364619 taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc 8364667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #256
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 15334917 - 15334965
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| |||||| || ||| ||||||| |||||||||||||||    
15334917 ggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta 15334965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #257
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15466131 - 15466187
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||| | |  ||||||||| ||||||||||||||||||    
15466131 tggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctg 15466187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #258
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||||| ||||| ||| ||||||||||| ||| |||| |||||||||||    
18928141 gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc 18928089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #259
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34383245 - 34383189
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  ||||||| |||| |||||||  | |||||||||||||||||||    
34383245 tggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctg 34383189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #260
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||    
51986459 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa 51986415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 102; Significance: 2e-50; HSPs: 267)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 50714566 - 50714386
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||          |||||||||||||||||||||              
50714566 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 50714467  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50714466 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 50714386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 6827874 - 6827694
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
6827874 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 6827775  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6827774 ttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 6827694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 35415299 - 35415478
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||           |||||||||||||||||||||              
35415299 ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 35415398  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35415399 ttgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 35415478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51709027 - 51708848
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||          |||||||||||||||||||||               
51709027 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 51708928  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
51708927 tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 51708848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 55482469 - 55482291
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||||  ||||||||||| |||||||||||||||||||||||||||||||          ||||||||||| |||| ||||                
55482469 tggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggttcctgtaaaattttttgttttt 55482370  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
55482369 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttgg 55482291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 16712691 - 16712514
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          |||||||||||| ||||||||            |    
16712691 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg 16712592  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
16712591 taaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaattttgtagtttttgg 16712514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 41620256 - 41620077
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||           |||||||||||||||||||||              
41620256 ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 41620157  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
41620156 ttgaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttggagtttttg 41620077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 13479273 - 13479449
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||||| |||||           |||||||||||||||| ||||            ||    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctataaaaaaaaattgtttttggtccctgtaaaattttttgtttttga 13479372  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
13479373 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 13479449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36702000 - 36702179
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg--tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||   |        |||||||| ||||||||||||               
36702000 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaatttttgtttttgtttttagtccctgcaaaattttttgtttt 36702099  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
36702100 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaattttgtagtttttgg 36702179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 38054549 - 38054724
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||            |||    
38054549 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 38054648  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||    
38054649 aatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaatcaattttgtagtttttgg 38054724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32208542 - 32208720
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||         ||||||||||||||| |||||                
32208542 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaattgtttttggtccctacaaaattttttgttttt 32208641  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||| ||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||    
32208642 gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaattttgtagtttttgg 32208720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 52017870 - 52017690
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             |||||||| ||||||||||||              
52017870 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaattttttgttt 52017771  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
52017770 ttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 52017690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 13064159 - 13064335
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||          |||||||||||||| ||||||            |    
13064159 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgtttttggtccccgcaaaattttttgtttttg 13064258  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| ||||||    
13064259 taaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacaaaaccaattttgtaatttttg 13064335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 41346218 - 41346039
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| ||||          |  ||||||||||||||||||               
41346218 ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaatcatttttggtccctgcaaaattttttgtttt 41346119  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41346118 tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 41346039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 29463913 - 29463736
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||            |||||||||||||||||||||               
29463913 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 29463814  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
     |||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||    
29463813 tgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagttttt 29463736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 22584607 - 22584432
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||| | ||||||||| |||||||||||| ||||||||||||||||||||| |        |||||||||||||||||||||            |    
22584607 ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttg 22584509  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||    
22584508 aaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaattttgtagtttttg 22584432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 41921084 - 41920905
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||| |||||||||||||  ||||||||||||||||||  |||          |||||||||||||||||||||               
41921084 ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 41920985  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41920984 tgaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 41920905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 4279336 - 4279155
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||||  |||||||||||||||||||| ||||||||||||||||||| ||             |||||||||||||| ||||||             
4279336 tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaataaggaaattttgtttttggtcccagcaaaatattttgtt 4279237  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4279236 tttgaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 4279155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 34355065 - 34355143
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34355065 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 34355143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 34362044 - 34361966
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34362044 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 34361966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 227 - 399
Target Start/End: Complemental strand, 27008401 - 27008228
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaaaa 325  Q
    |||||| ||||||||| ||||||||||||||||||||||||||||||||||           ||||||||||||| |||||||            |||||    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttttgaaaa 27008302  T
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
27008301 tagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg 27008228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 35763955 - 35763776
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||  |||||||||||||| ||||||||||||||||||||||||||||||        ||   |||||||||||||||||||              
35763955 ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgttt 35763856  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      ||||||||||||| |||||| |||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||    
35763855 ttgaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaattttctagtttttg 35763776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 45593228 - 45593404
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||          | |||||||||||||||||||                 
45593228 ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaaaaaaaaatagtttttggtccctgcaaaaatttttgtttttt 45593327  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
45593328 aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 45593404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 51545966 - 51545791
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||             ||    
51545966 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttcgtttttaaa 51545867  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
51545866 aatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 51545791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18205156 - 18205334
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||                
18205156 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 18205255  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||  ||||||||||||||||||||||||||||||||  |||||||| |||||| |||||||||||||||||    
18205256 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaactaattttgtagtttttgg 18205334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 27427944 - 27428022
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||    
27427944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaattttgtagtttttgg 27428022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 55072389 - 55072569
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||             ||||||||||||||| |||||              
55072389 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaaatttttgttt 55072488  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
55072489 ttaaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttatagtttttgg 55072569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 9289266 - 9289442
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt---nnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||           |||||||||||||||||||||              
9289266 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 9289365  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||| |||||| |||||||||||||||||||    |||||||||||||||||||||||| ||||||||||    
9289366 ttgaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaattttctagtttttgg 9289442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 396
Target Start/End: Complemental strand, 24474963 - 24474786
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||            ||||||| |||||||| ||||             
24474963 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagtaaaaaaaaaaaattgtttt-ggtccctgtaaaattttttgtt 24474865  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt 396  Q
       ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||    
24474864 tttgaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaattttgtagtttt 24474786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 389
Target Start/End: Complemental strand, 53717175 - 53717004
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             ||||||||| |||||||||||             
53717175 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaattttttgtt 53717076  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 389  Q
        |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
53717075 ttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 53717004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9446323 - 9446145
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||  |||||||||||| ||||||| |||||||||||||| |||||||           |||||||||||||||||||||                
9446323 ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 9446224  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||  |||||||||||||||||||||    
9446223 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataacaaaaccaattttgtagtttttgg 9446145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 18136014 - 18135936
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
18136014 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg 18135936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 49123222 - 49123144
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
49123222 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg 49123144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 5063013 - 5063183
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| |||||||||||||||||||| ||| |||||||||| |||||||| |        |||||||||||||||||||||            ||||    
5063013 taaaatat-gttttagtccctgcaaatataccttgttttggtttaagtccctg-taaaaaaaattgtttttggtccctgcaaaattttgatttt--gaaa 5063108  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||    
5063109 atagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaatcaattttgtagtttttgg 5063183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32365094 - 32365273
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||            |||||||||||||||||||||               
32365094 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 32365193  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||| ||||| ||||||||||||||||||||||||||||| ||  ||||||| ||||||||||||||||    
32365194 ttaaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgattttgtagtttttgg 32365273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 321 - 396
Target Start/End: Complemental strand, 123793 - 123718
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt 396  Q
    ||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
123793 gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaattttgtagtttt 123718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 3178784 - 3178861
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||||||||||||||||||| | ||||||||||||| || |||||||||||||||||||||||||||||||||    
3178784 gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaattttgtagtttttg 3178861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 52441763 - 52441939
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |        |||||||||||||||||||||                 
52441763 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 52441861  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||  |||||||| ||||||||||||||||||||||| ||| | || |||||||| ||||||||||||||||    
52441862 aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacccattttgtagtttttgg 52441939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45505894 - 45505713
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg----tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||     |        ||||||||||||||||||||              
45505894 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaattttttttttttgtttttggtccctgcaaatttttttgtt 45505795  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        ||| ||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||    
45505794 ttttaaattagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttgg 45505713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 2180573 - 2180394
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||           || ||||||||||||||||||               
2180573 tggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaaaaaaaaaattatttttggtccctgcaaaattttttgtttt 2180474  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||| |||||||||||||||||||||||  |||| || |||||||| ||||||||||||||||    
2180473 ttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacctattttgtagtttttgg 2180394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 46087860 - 46087936
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||| |||| |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
46087860 gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaattttgtagtttttgg 46087936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 22099912 - 22099732
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||             ||||||||||||| |||||||              
22099912 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt 22099813  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
22099812 tttaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 22099732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 50822178 - 50822120
Alignment:
340 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50822178 acttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 50822120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 18830946 - 18831023
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||| ||| || |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||    
18830946 gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaactttgtagtttttg 18831023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 27008083 - 27008139
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27008083 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 27008139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 35415634 - 35415576
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
35415634 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 35415576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 35763647 - 35763704
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
35763647 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 35763704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 41345853 - 41345910
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41345853 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41345910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13064465 - 13064410
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
13064465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 13064410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 52017505 - 52017560
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
52017505 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 52017560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 15555560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41619902 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 41619956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 50714239 - 50714297
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
50714239 tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 50714297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 333 - 399
Target Start/End: Original strand, 52429825 - 52429891
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||| |||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||    
52429825 tgaccccatttttgtgatgatttgcatacgtggcacattataacttaataaattttgtagtttttgg 52429891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 123534 - 123591
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
123534 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 123591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 22099542 - 22099595
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22099542 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 22099595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 23245230 - 23245286
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
23245230 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23245286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 29380668 - 29380724
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||    
29380668 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg 29380724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35464383 - 35464327
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
35464383 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35464327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 42848392 - 42848336
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
42848392 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 42848336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 278
Target Start/End: Complemental strand, 46088060 - 46088004
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
46088060 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg 46088004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46115413 - 46115469
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
46115413 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 46115469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46128547 - 46128603
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
46128547 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 46128603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2034855 - 2034800
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||    
2034855 ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg 2034800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2180220 - 2180275
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
2180220 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 2180275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8760604 - 8760659
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
8760604 ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg 8760659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13479611 - 13479556
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
13479611 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13479556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13530713 - 13530658
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
13530713 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 13530658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24774045 - 24774100
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
24774045 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24774100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29499182 - 29499237
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29499182 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30046792 - 30046737
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
30046792 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 30046737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30061133 - 30061078
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
30061133 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 30061078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32365483 - 32365428
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
32365483 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 32365428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43231389 - 43231334
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
43231389 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 43231334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45505600 - 45505655
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    
45505600 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 45505655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 11285558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||    
15555637 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc 15555587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 23778964 - 23779014
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||    
23778964 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 23779014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 28809180 - 28809126
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||    
28809180 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct 28809126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 6827546 - 6827603
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||    
6827546 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggt 6827603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 9289639 - 9289582
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
9289639 ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 9289582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||    
9445951 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 9446004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 392
Target Start/End: Complemental strand, 29420537 - 29420365
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg--tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||    |        ||||||||  |||||||||||               
29420537 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattttttttattgttttttatccctgcaaaatattttgtttt 29420438  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
     |||||||||| || ||||||||||||||||||| |||||||||||||||| || | |||||| |||||||||    
29420437 tgaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccattttgtag 29420365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 51708693 - 51708750
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||    
51708693 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggt 51708750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 4211561 - 4211617
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||    
4211561 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg 4211617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 5052584 - 5052532
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||| ||||| |||||||||||||||||||||||||||||||||||||||||    
5052584 ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 5052532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 8191392 - 8191336
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||    
8191392 tggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg 8191336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||    
8904886 ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 13073758 - 13073814
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13073758 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13073814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 26412585 - 26412529
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
26412585 tggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 26412529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 29380910 - 29380858
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
29380910 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 29380858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29499543 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 34361803 - 34361855
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
34361803 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 34361855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 46292391 - 46292447
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||    
46292391 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 46292447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||||||||||||||||||| ||||||    
55072709 taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 55072657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5827973 - 5827918
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
5827973 ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 5827918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5882552 - 5882606
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
5882552 ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg 5882606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8760781 - 8760726
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||    
8760781 ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg 8760726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 11692870 - 11692929
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||||||| |||||||||||||| || |||||||| ||||    
11692870 gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacccattt 11692929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12791974 - 12791919
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
12791974 ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg 12791919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13631228 - 13631283
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13631228 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13631283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13631599 - 13631544
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13631599 ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 13631544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14487802 - 14487857
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||    
14487802 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg 14487857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
14791806 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14791751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25423924 - 25423979
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
25423924 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25423979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25424312 - 25424257
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
25424312 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25424257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35464018 - 35464073
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35464018 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35464073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43231088 - 43231143
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
43231088 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 43231143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46115779 - 46115724
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||    
46115779 ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46115724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46128913 - 46128858
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||    
46128913 ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46128858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 46292651 - 46292600
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||    
46292651 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc 46292600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 47274231 - 47274180
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||||    
47274231 tggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 51545629 - 51545680
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||||    
51545629 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc 51545680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 52430100 - 52430045
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||    
52430100 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg 52430045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 52442092 - 52442037
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||    
52442092 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg 52442037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 53915683 - 53915738
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
53915683 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 53915738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 54903475 - 54903420
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||    
54903475 ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg 54903420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||||||||||||| |||||||||||||||||||||||    
6353637 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg 6353583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 32208901 - 32208847
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||| |||||||||||||||||||||||| |||||||||||    
32208901 ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct 32208847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| |||||||| |||||| ||||||||||||||||||||||||||||    
36702362 gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg 36702308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||    
51763201 gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg 51763147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||    
7642544 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 7642491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 18205468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 43368467 - 43368644
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    ||||||||| |||||||||||||||||||||  |||||||||||||||||||||           ||||||||||||||||||||              |    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttta 43368566  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa-ccaattttgtagtttttgg 399  Q
    ||||||||  |||||||| |||| |||||||||||||||||||||||| || | |||| ||| |||||||||||||||    
43368567 aaatagtcgttgaccccatttttatgatgatttgcatacgtggcacataatgaatgaacccatttttgtagtttttgg 43368644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||| ||||| || |||||||||||||||||||    
51830891 ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg 51830944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5827654 - 5827710
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
5827654 tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 5827710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13074125 - 13074073
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||||||||||| ||||||||||||||||||||    
13074125 ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc 13074073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 19321860 - 19321804
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||  |||||||||||||||||||||    
19321860 tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 19321804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 25358460 - 25358396
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||||||||||| | ||||||||||| || |||||||  |||||||||    
25358460 gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaactcattttgtag 25358396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 28809010 - 28809066
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| ||||||||||  |||||||||||||||||||||    
28809010 tggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg 28809066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
30060772 taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg 30060824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31560696 - 31560640
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
31560696 tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 31560640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 41324891 - 41324835
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||  || ||||||||||||||||||||||||||||||||||    
41324891 tggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg 41324835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 53308069 - 53308013
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| | ||||||||||||||||||||    
53308069 tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg 53308013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 53716921 - 53716973
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| || ||||||||||||||||    
53716921 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 53716973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4279022 - 4279077
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||| ||||||||||||  ||||||||||||||||||||||    
4279022 ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg 4279077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 5797711 - 5797652
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
5797711 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5797652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11693121 - 11693066
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||| ||||||||||||    
11693121 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 11693066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12152493 - 12152438
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||| |||||||    
12152493 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg 12152438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 13530488 - 13530547
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
13530488 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 13530547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||| ||||||||    
13764613 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg 13764668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14488187 - 14488132
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
14488187 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 14488132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 20291986 - 20292037
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||    
20291986 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc 20292037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 22584287 - 22584338
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||    
22584287 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc 22584338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23245595 - 23245540
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
23245595 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 23245540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23779225 - 23779170
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| |||||||||||||| ||| ||||||||||||||||||    
23779225 ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg 23779170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 25424203 - 25424144
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
25424203 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 25424144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26412190 - 26412245
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
26412190 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 26412245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27427872 - 27427926
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||    
27427872 ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg 27427926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 28448834 - 28448885
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||| | |||||||||||||||||||||||||||    
28448834 ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc 28448885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31560331 - 31560386
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||||||||||||| |||||||||||||||||||||    
31560331 ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg 31560386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31812213 - 31812158
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||||||||||| ||||||||||||||||||||||    
31812213 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 31812158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34355283 - 34355228
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||  ||||||| ||||||||||||||||||||||    
34355283 ggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg 34355228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35119292 - 35119347
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||  ||||||||||||||||||||    
35119292 ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg 35119347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36054150 - 36054095
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  ||||| ||||||||||||||||||| ||||||||||||||||||    
36054150 ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg 36054095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42848027 - 42848082
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||||||||||| ||||||||||||||||||||||    
42848027 ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg 42848082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 45474596 - 45474545
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||||||||||||||| ||| |||||||||||||    
45474596 ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc 45474545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45593586 - 45593531
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||||||||||| ||||    
45593586 ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg 45593531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 53916047 - 53915992
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||| ||||    
53916047 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 53915992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 2034552 - 2034594
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||||||||||||||||||||||    
2034552 ttttggtccctgcaaatatgcctcgttttggttttagtccctg 2034594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||||| |||||||||||||||||||||||||| ||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg 2322148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||||||||||||||||||||||||||||| |||||||||    
5827764 gtccctgaccccacttttgtgatgatttgcatatgtggcacat 5827806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 19903603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| ||||| ||||||||| ||||||||||||||||||||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 36050343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||||||||||||| |||||||||| ||||||||||||    
37557194 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg 37557140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| ||| | ||||||||||||||||||||||||||||||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg 44925790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 279
Target Start/End: Complemental strand, 123893 - 123840
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagt-ccctggt 279  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||| |||||||    
123893 aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggt 123840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 11285605 - 11285682
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||||| |||||||||||||||||||| ||||| |  || |||| | | ||||||||||||||||    
11285605 aaaatagtctctgaccccatttttgtgatgatttgcatacatggcataagatgactggatccattttgtagtttttgg 11285682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| |||||| |||||||||||||||||||||||||| ||||||    
16712331 ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc 16712380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||| ||||||| || |||||||||||||||||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg 18831123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 29463609 - 29463658
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||||| |||||| | ||||||||||||||||||||||||||||    
29463609 tggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta 29463658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||||||||||||||||||  | |||||||||||||||||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg 30564888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||    
51738362 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac 51738309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 55805089 - 55805036
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||||||||| || | ||||||||||||| ||||||||||||||||    
55805089 tggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc 55805036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcg-ttttggttttagtccct 276  Q
    |||||||| ||||| |||||||||||||||||||| |||||||||||||||||    
5202929 taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct 5202981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||||||||||||||||||| ||||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 14791550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||||||||||||||||||||||| ||||||| |||||    
20144423 taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg 20144475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 24474600 - 24474651
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
24474600 ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc 24474651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 25358541 - 25358485
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||| ||||||| ||||||||||||||||||||||    
25358541 tggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg 25358485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||    
54208822 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 54208774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2322432 - 2322377
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||| ||||    
2322432 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg 2322377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4211610 - 4211669
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| ||||||||||| || | |||||| ||||    
4211610 gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 4211669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12152154 - 12152209
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||  |||||||||||||    
12152154 ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg 12152209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13530379 - 13530434
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||| ||||||||||||    
13530379 ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 13530434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18136113 - 18136058
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||   |||| ||||| |||||||||||||||||||||||||||||||    
18136113 ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg 18136058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19321570 - 19321625
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||| ||| ||||||||||||||||||||||||||    
19321570 ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg 19321625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19903261 - 19903316
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||  |||||||||||||| ||| ||||| ||||||||||||    
19903261 ggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctg 19903316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 24774318 - 24774259
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
24774318 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 24774259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26314332 - 26314277
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||| ||||||| ||||||||||||||||||||||    
26314332 ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg 26314277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 31182504 - 31182449
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| | |||||||||||| ||||||||||||| ||||||||    
31182504 ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg 31182449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31811925 - 31811980
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||||||||||||  |||||||||||||||||||||    
31811925 ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg 31811980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 34354972 - 34355020
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||    |||||||||||||||||||||||||    
34354972 taaaatatagttttagtccctgca----tgcctcgttttggttttagtccctg 34355020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| |||||||||||||||||||||||||||||| ||||||||    
36050359 ttttggtccctgcaaatatgcctcgttttggttttggtccctgg 36050402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 36050395 - 36050454
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| |||||||| || || |||||||| ||||    
36050395 gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacccattt 36050454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37556841 - 37556896
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||| || ||||||||| ||||| |||||||||||||||||    
37556841 ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg 37556896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42823776 - 42823831
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||| ||||||||||||||||| ||||    
42823776 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg 42823831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 44925485 - 44925536
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||    
44925485 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 44925536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| ||||| |||| |||||||||| |||||||||||||||||||||    
47022743 taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct 47022794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47023105 - 47023050
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||||||||||||  |||||||||||||||||||||    
47023105 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg 47023050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 47135887 - 47135942
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||||    
47135887 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacca 47135942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||| ||||||||||||||| ||| |||||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 47136119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 49123321 - 49123266
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||   |||| ||||| |||||||||||||||||||||||||||||||    
49123321 ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg 49123266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51738137 - 51738192
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||| ||||||||||||||| ||||||    
51738137 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg 51738192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 51738411 - 51738356
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| |||||||||||||||||||| |||| |||||||    
51738411 ggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg 51738356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 238 - 277
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
238 tagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||| ||||||||||||||||||    
54208477 tagtccctgcaaatatgcctcattttggttttagtccctg 54208516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 54208716 - 54208657
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
54208716 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 54208657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 11692762 - 11692816
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||| | ||||| ||||||||||||||||| ||||||| |||||||||||    
11692762 ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct 11692816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||||||| |||||||||||||||||||| ||||| ||||| || ||||||||    
12791865 gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 12791811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 31370804 - 31370854
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||||||  |||| ||||||||||||||||||||||||    
31370804 ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt 31370854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 8191288 - 8191216
Alignment:
322 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||| ||||  | |||||||  |||||||||    
8191288 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag 8191216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||| ||| ||||||||||||||||| ||||||||||| || |||||||    
14488078 gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac 14488025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||| |||||||||| | |||||||||||||||||||    
35420393 ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg 35420446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| |||| |||||||||| |||| |||||||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg 35420648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 333 - 382
Target Start/End: Original strand, 41439902 - 41439951
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||| ||||||||||||||||||| ||||||||||| || ||||||||    
41439902 tgaccctacttttgtgatgatttgcacacgtggcacatgatgactgaacc 41439951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 42824092 - 42824039
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||| ||||||||||||||| || |||||| |||||||||    
42824092 tggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc 42824039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||  |||| ||| ||||||||||| ||||||||||||||||||||||    
5797484 taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg 5797536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||||| |||||||| ||||||||||||||| ||||||    
5797817 taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg 5797765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13764807 - 13764755
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||| |||||||  ||||||||||||||||||    
13764807 ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc 13764755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14594206 - 14594258
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||  ||||||||||||||    
14594206 ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 14594258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 358
Target Start/End: Complemental strand, 14791759 - 14791727
Alignment:
326 tagtccctgaccccacttttgtgatgatttgca 358  Q
    |||||||||||||||||||||||||||||||||    
14791759 tagtccctgaccccacttttgtgatgatttgca 14791727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 20144731 - 20144683
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| || | ||||||||||||||||||||||||||    
20144731 ggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta 20144683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26313987 - 26314043
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||  ||||||||||||||   ||||||||||||||||||||    
26313987 tggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg 26314043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 29380717 - 29380769
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||| |||||||||||| |||||||||| ||||||||||| || ||||||    
29380717 gtccctggccccacttttgtaatgatttgcacacgtggcacatgatgactgaa 29380769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 35119611 - 35119559
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||| ||||||||||| ||||||||||||| |||||    
35119611 ggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc 35119559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #225
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 392
Target Start/End: Original strand, 46292441 - 46292505
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||| ||||||||||||||||||||||| ||||| ||||| || ||| || | |||||||||    
46292441 gtccctgcccccacttttgtgatgatttgcacacgtgacacatgatgactaaatccattttgtag 46292505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #226
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||| |||||||  || ||||||||||||||||||    
50822013 taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg 50822065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #227
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| |||| |||||||||| |||||||||||||||    
52543422 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 8905235 - 8905180
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| ||||||| ||||||||||| ||||| ||||| |||||    
8905235 tggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct 8905180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 223 - 254
Target Start/End: Original strand, 12791610 - 12791641
Alignment:
223 gctaaaatatagttttagtccctgcaaatatg 254  Q
    ||||||||||||||||||||||||||||||||    
12791610 gctaaaatatagttttagtccctgcaaatatg 12791641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 19903370 - 19903429
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| || |||||||||||||||||||| | ||||||||| || | |||||||||||    
19903370 gtccctggccacacttttgtgatgatttgcacatgtggcacatgatgagtgaaccaattt 19903429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 24774354 - 24774311
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
24774354 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 24774311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 25358497 - 25358454
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||| |||||||||||| | |||||||    
25358497 gttttagtccctgcaaatatgtctcgttttggttgtggtccctg 25358454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 31811996 - 31812039
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
31811996 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 31812039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 35119380 - 35119431
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| |||||| |||| || |||||||| ||||    
35119380 ccccacttttgtgatgatttgcacacgtggtacatgatgactgaacccattt 35119431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||| ||||||||||||||||||||| ||| ||||| |||||||    
41920771 taaaatatggttttagtccctgcaaatatgactcattttgattttagt 41920818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 42848282 - 42848227
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
42848282 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 42848227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46115670 - 46115611
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
46115670 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46115611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #238
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46128804 - 46128745
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
46128804 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 46128745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #239
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 47022996 - 47022937
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
47022996 gtccctggctccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 47022937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #240
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 47135851 - 47135894
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
47135851 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 47135894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #241
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51762870 - 51762925
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| || || ||| |||||||||||| || ||||||||||||||||||    
51762870 ggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg 51762925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #242
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 51763129 - 51763086
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
51763129 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 51763086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 338 - 380
Target Start/End: Complemental strand, 2034735 - 2034693
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
2034735 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 2034693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
5797747 ttttggtccctgcaaatatgcctcattttggttttggtccctg 5797705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||||||||| |||| |||||||    
11692834 ttttggtccctgcaaatatgcctcgttttgattttggtccctg 11692876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
13530452 ttttggtccctgcaaatatgcctcattttggttttggtccctg 13530494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #247
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
20144492 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 20144534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #248
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
25424239 ttttggtccctgcaaatatgcctcattttggttttggtccctg 25424197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #249
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 381
Target Start/End: Complemental strand, 28449123 - 28449065
Alignment:
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| | |||||||| |||||||||||||||||||| ||||| || || |||||||    
28449123 aaatagttcatgaccccatttttgtgatgatttgcatacatggcatatgatgactgaac 28449065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #250
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 47023027 - 47022989
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||| |||||||||| ||||||||    
47023027 gtccctgcaaatatgcctcattttggttttggtccctgg 47022989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #251
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 277
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||| ||||| |||| |||||||||| ||||||||||||||||| ||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg 47532617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #252
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 54208747 - 54208709
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||| |||||||||| ||||||||    
54208747 gtccctgcaaatatgcctcattttggttttggtccctgg 54208709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 332 - 369
Target Start/End: Complemental strand, 12152380 - 12152343
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcaca 369  Q
    |||||||||||||||||||||||||||  |||||||||    
12152380 ctgaccccacttttgtgatgatttgcactcgtggcaca 12152343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
14594494 ttttggtccctgcaaatatgtctcgttttggttttggtccct 14594453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| |||||||||| || |||||||| ||||||||||||||||||    
18135793 taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc 18135841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| |||||||||| || |||||||| ||||||||||||||||||    
49123000 taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc 49123048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #257
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||||||||||||||||||||||||||| || ||||| ||||| || |||||||    
50754146 gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac 50754094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #258
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
54903403 ttttggtccctgcaaatatgtctcgttttggttttggtccct 54903362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #259
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||| ||||||||||||||| ||| ||||||||||||||||    
2034781 ttttggtccctgcaaatatgtctcattttggttttagtccc 2034741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #260
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 331 - 383
Target Start/End: Original strand, 19321682 - 19321734
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    |||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
19321682 cctgactccacttttgtgataatttgcacacgtgacacatgatgactgaacca 19321734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #261
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||| ||||| |||||||||| |||||||| |||||||||||||||    
20292284 aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc 20292237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #262
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 28449214 - 28449166
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| |||| |||||||||| ||||||||| |||||    
28449214 ggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #263
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 43368778 - 43368722
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||| | || |||||||||  |||||||||||||||| ||||    
43368778 tggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctg 43368722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #264
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||  || |||||||||||||| ||||    
50753925 taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg 50753977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #265
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 52543620 - 52543568
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    |||| ||||||||||||| |||||||||||| ||||| ||||| || ||||||    
52543620 gtccatgaccccacttttctgatgatttgcacacgtgtcacatgatgactgaa 52543568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #266
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 52642181 - 52642129
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||| ||||||| ||||||||| ||||||||| || | ||||||||||||||    
52642181 tggcttaaatatatttttagtccttgcaaatataccactttttggttttagtc 52642129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #267
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Complemental strand, 54903359 - 54903315
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    |||||||||||||||||||||||  |||| ||||| |||||||||    
54903359 ccccacttttgtgatgatttgcaagcgtgacacataataactgaa 54903315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 289 - 110
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||          |||||||||||||||||||||               
289 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 190  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
189 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 101; Significance: 6e-50; HSPs: 231)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 221 - 397
Target Start/End: Original strand, 4375691 - 4375867
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||          |||||||||||||||||||||                
4375691 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 4375790  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4375791 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 4375867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 4016906 - 4017082
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||           ||||||||||||||||||||             |    
4016906 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaaaaaaaaatgtttttggtccctgcaaaattttttgtttttta 4017005  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4017006 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 4017082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 395
Target Start/End: Original strand, 19494119 - 19494294
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||          |||||||||||||||||||||               
19494119 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccctgcaaaattttttggttt 19494218  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 395  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19494219 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 19494294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38930302 - 38930481
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||| ||||||| ||||||||||||||||| ||||||          |||||||||||||||||||||               
38930302 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 38930401  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38930402 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 38930481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 1525809 - 1525989
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||            |||||||||||||||||||||              
1525809 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 1525908  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
1525909 ttgaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaattttgtagtttttgg 1525989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 33636322 - 33636502
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||           |||||||||||||||||||||              
33636322 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaattttttgttt 33636421  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
33636422 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaattttgtagtttttgg 33636502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 16644044 - 16643864
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||           |||||||||||||||||||||              
16644044 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaattttttgttt 16643945  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
16643944 ttgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttgg 16643864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 223 - 399
Target Start/End: Complemental strand, 6146948 - 6146769
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||| |||||||||||||||||||||| |||||||||||||||||||||             ||||||||||||||||||||                
6146948 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaatttttttgtttt 6146849  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6146848 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 6146769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 28399035 - 28398860
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  ||||||||||||||||||||  |||||||||||||||||||||          |||||||||||||||||||||            |    
28399035 ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg--taaaaaaattgtttttggtccctgcaaaattttttgtttttg 28398938  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
28398937 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 28398860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 1162908 - 1163091
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||           |||||||||||||||||||||             
1162908 tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtg 1163007  T
318 nnn--gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
         |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
1163008 tttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 1163091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8094479 - 8094659
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||           | |||||||||||||||||||              
8094479 ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaattttttgttt 8094578  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
8094579 ttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 8094659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 16789370 - 16789194
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          || |||||||||||| ||||||               
16789370 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtcccagcaaaattttgtttt-- 16789273  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
16789272 -gaatatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg 16789194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 24187569 - 24187746
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||          |||||||||| || ||||||             |    
24187569 ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaattgtttttggcccgtgcaaatttttttgtttttg 24187668  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
24187669 aaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaattttgtagtttttgg 24187746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 10776500 - 10776319
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||             |||||||| ||||||||||||             
10776500 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaattttttgtt 10776401  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
10776400 tttgaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaattttgtagtttttgg 10776319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 384
Target Start/End: Original strand, 40492960 - 40493117
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||          || ||||||||||||||||||            |    
40492960 ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg-----taattttttttttggtccctgcaaaattttttgtttttg 40493054  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 384  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40493055 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 40493117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1408353 - 1408175
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||            |||||||||||||||||||||                
1408353 ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttattttt 1408254  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||    
1408253 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaattttatagtttttgg 1408175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 24955010 - 24954832
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||         || |||||||||| |||||||                
24955010 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaaaaaaaattatttttggtccttgcaaaaaaatttgttttt 24954911  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||  |||||||||||||||||||||    
24954910 gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataacaaaaccaattttgtagtttttgg 24954832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 6146517 - 6146694
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||| ||           |||||||||||||||||||||            |    
6146517 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 6146616  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||||    
6146617 aaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattaggttgtttttgg 6146694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 21509796 - 21509873
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
21509796 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccagttttgtagtttttg 21509873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14495299 - 14495221
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||    
14495299 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaattttgtagtttttgg 14495221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22650464 - 22650646
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt-----tgtttttggtccctgcaaaannnnnnnn 316  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||          |     ||||||||||||||||||||            
22650464 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaataatattgtttttggtccctgcaaaattttttgt 22650563  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||    
22650564 ttttgaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaattttgtagtttttgg 22650646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 22917826 - 22917748
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
22917826 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 22917748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 25131210 - 25131288
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
25131210 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 25131288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 27341591 - 27341411
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             || ||||||||||||||||||              
27341591 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttgttt 27341492  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||| ||||||||||||||| | || ||||| |||||||||||||||||||||||||||||||||||||||||    
27341491 ttgaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaattttgtagtttttgg 27341411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 21125919 - 21125842
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
21125919 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 21125842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 40066497 - 40066673
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||          ||||||||||||| |||||||            |    
40066497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaaaaaaaaattgtttttggtcc-tgcaaaattttttgtttttg 40066595  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| || |||||||    
40066596 aaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttataatttttgg 40066673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 7272420 - 7272600
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||             ||||||||||||||||| |||              
7272420 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaagaaaattttgtttttggtccctgctaaataatttgttt 7272519  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||  |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
7272520 ttgaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaattttgtagtttttgg 7272600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14488716 - 14488894
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||          || ||||||||||| ||||||                 
14488716 ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaaaaaaaaatttgtttttggtccttgcaaatttttttgttttt 14488815  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||| || |||||||| ||||||||||||||||    
14488816 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtagtttttgg 14488894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 32040272 - 32040195
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||    
32040272 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaattttgtagtttttg 32040195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 225 - 379
Target Start/End: Original strand, 1685117 - 1685274
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||           |||||||||||| ||||||||            |    
1685117 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtcactgcaaaattttttgcttttg 1685216  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 379  Q
    ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||    
1685217 aaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga 1685274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 33526051 - 33526232
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| |||||||||||||||||||||| ||| |||||||||||||| ||    |        |||||||||||||||||||||             
33526051 tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtccatgtgaatttttttgtttgtttttggtccctgcaaaattttttgtt 33526150  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||    
33526151 ttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatagtttttgg 33526232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 15719758 - 15719835
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
15719758 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg 15719835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14238751 - 14238929
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||            ||||||||||||| |||||||               
14238751 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtcc-tgcaaaattatttgtttt 14238849  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||| ||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||    
14238850 ttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacccattttgtagtttttgg 14238929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29158354 - 29158534
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||             ||||||||| |||||||||||              
29158354 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaattttttgttt 29158453  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||| || |||||||||||||||| ||||  ||||||| |||| |||||||||||||||||||||||||||||    
29158454 ttgaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaattttgtagtttttgg 29158534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29488110 - 29487932
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||           ||||||||||||||||||||                 
29488110 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgttttt 29488011  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| |||||||| ||||||||||||||||||| ||||||||| || ||||||||  |||||||||||||||    
29488010 taaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaaccctttttgtagtttttgg 29487932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 19963099 - 19963176
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| |||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||    
19963099 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaaccgattttgtagtttttgg 19963176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 14496816 - 14496991
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||  |        ||||||||||||| |||||||            |    
14496816 ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtcccta-taaaaaaaattgtttttggtccttgcaaaattttttgtttttg 14496914  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||| |||||||||| || ||||||||||||||||||| ||||||||| || |||||||| |||||||| ||||||    
14496915 aaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttg 14496991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 18549305 - 18549383
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||    
18549305 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctattttgtagtttttgg 18549383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 30337023 - 30337101
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||| |||||||||||||||||||||||| | || || |||||||| ||||||||||||||||    
30337023 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgatgactgaacccattttgtagtttttgg 30337101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 10755429 - 10755352
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
10755429 aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 10755352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19494413 - 19494356
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
19494413 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 19494356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 22917564 - 22917621
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
22917564 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 22917621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 32418577 - 32418500
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||    
32418577 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttgg 32418500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 43477411 - 43477334
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||| | ||||| || |||||||| ||||||||||||||||    
43477411 aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaaccgattttgtagtttttgg 43477334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 43727328 - 43727251
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||||| || |||||||| ||||||||||||||||    
43727328 aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacccattttgtagtttttgg 43727251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4621355 - 4621299
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
4621355 tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 4621299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14239080 - 14239025
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
14239080 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 14239025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21125719 - 21125774
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
21125719 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg 21125774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 43477163 - 43477218
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
43477163 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 43477218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35143844 - 35143667
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||| ||| || ||||||||||||||||||||||||||||||           |||||||||||||||||||||                
35143844 ggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctgaaaaaaaaaaattgtttttggtccctgcaaaattttttattttt 35143745  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| |||||||| ||||||||||||||||||| ||||||||| ||||| ||||| ||||| ||||||||||    
35143744 taaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaaccgattttatagtttttgg 35143667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 1526172 - 1526115
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
1526172 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt 1526115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 7578429 - 7578352
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||  |||||| | ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
7578429 aaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 7578352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 16643661 - 16643718
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
16643661 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 16643718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 40844434 - 40844357
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || | ||| || ||||||||||||||||    
40844434 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgattgagccgattttgtagtttttgg 40844357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 2728598 - 2728542
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
2728598 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2728542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7272752 - 7272696
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
7272752 tggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg 7272696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7326422 - 7326366
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
7326422 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 7326366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 32418318 - 32418370
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
32418318 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 32418370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35097693 - 35097637
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
35097693 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35097637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40066821 - 40066765
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
40066821 tggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg 40066765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40844155 - 40844211
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||    
40844155 tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 40844211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4017300 - 4017245
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
4017300 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 4017245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4710220 - 4710165
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
4710220 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 4710165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11019857 - 11019802
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
11019857 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11019802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11976373 - 11976428
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
11976373 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11976428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14495069 - 14495124
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
14495069 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 14495124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 25131448 - 25131393
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
25131448 tggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct 25131393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28346394 - 28346449
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
28346394 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28346758 - 28346703
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
28346758 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32726271 - 32726216
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
32726271 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 32726216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33526412 - 33526357
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
33526412 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 33526357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 34963300 - 34963355
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
34963300 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 34963355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37536086 - 37536141
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
37536086 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 37536141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 8094841 - 8094788
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||    
8094841 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc 8094788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 38930664 - 38930607
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||| ||||||||    
38930664 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt 38930607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1778563 - 1778619
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
1778563 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7186005 - 7185949
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
7186005 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7185949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 8298586 - 8298642
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
8298586 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8298642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 10873281 - 10873225
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
10873281 tggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 10873225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 14489074 - 14489018
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
14489074 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14489018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 34963665 - 34963609
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
34963665 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 34963609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35346628 - 35346684
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35346628 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 37536420 - 37536364
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
37536420 tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 37536364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 42133155 - 42133099
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
42133155 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 42133099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3511906 - 3511961
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||    
3511906 ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg 3511961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3512266 - 3512211
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
3512266 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3512211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4474044 - 4473989
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
4474044 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 4473989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7326086 - 7326141
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||    
7326086 ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg 7326141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7420230 - 7420285
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
7420230 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7420285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 7420590 - 7420535
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
7420590 ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg 7420535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8298975 - 8298920
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
8298975 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8298920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9496723 - 9496668
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
9496723 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 9496668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10337119 - 10337174
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
10337119 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10337174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10337449 - 10337394
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
10337449 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 10337394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10540782 - 10540727
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
10540782 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 10540727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10872915 - 10872970
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
10872915 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 10872970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11019520 - 11019575
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
11019520 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11019575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 13154886 - 13154941
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||  ||| |||||||||||||||||||||||||||||||||    
13154886 ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg 13154941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16789075 - 16789130
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
16789075 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 16789130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 18549201 - 18549252
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||    
18549201 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc 18549252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20277692 - 20277747
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
20277692 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 20277747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20984146 - 20984201
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
20984146 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 20984201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21064319 - 21064374
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
21064319 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 21064374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21126021 - 21125966
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||||||| || ||||||| ||||||||||||||||||||||    
21126021 ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg 21125966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24187897 - 24187842
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||||||||||||||||||| ||||||||||||||||||||||    
24187897 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg 24187842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25131111 - 25131166
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||    
25131111 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 25131166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25600597 - 25600542
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| ||||||||||||||| || |||||||||||||||||||    
25600597 ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg 25600542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 28497363 - 28497422
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||    
28497363 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 28497422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32725907 - 32725962
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
32725907 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 32725962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35097328 - 35097383
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35097328 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35097383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 35115590 - 35115531
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||    
35115590 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 35115531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35345617 - 35345562
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||    
35345617 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg 35345562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35346998 - 35346943
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35346998 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 5357423 - 5357477
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||  |||| |||||||||||||||||||||||||||||||||||||    
5357423 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct 5357477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 10540449 - 10540503
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||    
10540449 ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct 10540503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||    
10755528 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct 10755474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 275
Target Start/End: Original strand, 15719655 - 15719709
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||||||| ||||||||||||||||||||  ||||||||||||||||||||    
15719655 tggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc 15719709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||| ||||| ||||||||||||||||||||||||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc 24090437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 28323849 - 28323903
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||    
28323849 ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct 28323903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 268
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt 268  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||    
30337217 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt 30337171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||||| || |||||||| ||||||||||||||||||||||||||||||    
14495389 gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc 14495337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg 18549518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
11976733 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11976681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 13232253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 20278057 - 20278005
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||| |||||||||||||||||||||||||    
20278057 ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc 20278005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 21064684 - 21064632
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||| |||||||||||||||||||||||||    
21064684 ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc 21064632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 28497564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||  ||||||||||||||||||||||    
40844532 taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg 40844480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 42132863 - 42132919
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||||    
42132863 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg 42132919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2728232 - 2728287
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||| ||||||||||||||||||||||    
2728232 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg 2728287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4473704 - 4473759
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||| | ||||||||||||||||||||||    
4473704 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 4473759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6469280 - 6469335
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| | ||| ||||||||||||||||||||||||||||||||| ||||    
6469280 ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg 6469335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 8298696 - 8298755
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
8298696 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 8298755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9496341 - 9496396
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||| ||||    
9496341 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 9496396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 13232563 - 13232512
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| ||||||||||||||||||| |||||||||||||    
13232563 tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 13232512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17073807 - 17073862
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
17073807 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 17073862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17574463 - 17574408
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
17574463 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 17574408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20984510 - 20984455
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||| ||||||||||||||||||||||    
20984510 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 20984455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25600230 - 25600285
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||| ||||    
25600230 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 25600285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 321 - 392
Target Start/End: Original strand, 32195381 - 32195452
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||||||| |||||||||||||| ||||||| |||||||||| ||||| || | |||||| |||||||||    
32195381 gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacatgatgattgaacctattttgtag 32195452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35115639 - 35115584
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||| ||||||| ||||||||||||||| |||||||    
35115639 ggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg 35115584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 1163275 - 1163217
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| |||||||||| |||||||||||| |||||| ||||||||| |||||    
1163275 tggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggt 1163217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||    
10776150 ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10776196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| | ||| |||||||||||||||||||||||||||||||| |||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg 13779477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 27117976 - 27117922
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| ||||||||||||||||||| |||||||||| ||||||    
27117976 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct 27117922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 267
Target Start/End: Complemental strand, 40493158 - 40493112
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtt 267  Q
    |||||||||| | ||||||||||||||||||||||||||||||||||    
40493158 tggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt 40493112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| ||||||||||||||||||||| | ||||||||||| ||||||||||    
20277801 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 20277854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| ||||||||||||||||||||| | ||||||||||| ||||||||||    
21064428 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 21064481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 29158670 - 29158617
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||| |||||||||||||  |||||||||||||||||||    
29158670 tggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc 29158617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||||||| ||||||||||||||||||||||||||    
9175368 taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 9175320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28497255 - 28497307
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||| |||||||||||||||||||||||| ||||||||||    
28497255 ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc 28497307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 42430068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 333 - 388
Target Start/End: Original strand, 2811555 - 2811610
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
    |||||||||||||||||||||||| ||||||||||||| || ||| |||| |||||    
2811555 tgaccccacttttgtgatgatttgtatacgtggcacatgatgactaaacccatttt 2811610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3680801 - 3680746
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  ||||  ||||||||||||||||||||||||||||| |||||||    
3680801 ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg 3680746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 4376010 - 4375960
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||||||||||||||||||| ||| |||||||||||||    
4376010 ggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc 4375960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 6469557 - 6469498
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||  | |||||||||||||| |||||||| ||||    
6469557 gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacccattt 6469498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 7326195 - 7326254
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
7326195 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7326254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||||||||||||||||||||||| |||||||||| ||||||||    
7420303 ttttagtccctgcaaatatgcctcattttggttttggtccctgg 7420346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 7420339 - 7420398
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
7420339 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 7420398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9175012 - 9175067
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| |||| |||||||||| ||||||||||||||||||||||    
9175012 ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg 9175067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13155251 - 13155196
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||||||||||| ||||||||||||||| ||||||    
13155251 ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg 13155196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||||||||||||||||||||||| |||||||||| ||||||||    
13232271 ttttagtccctgcaaatatgcctcattttggttttggtccctgg 13232314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19962995 - 19963050
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| || ||||||| |||||||||| |||||||| |||||||||||||    
19962995 ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg 19963050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||    
20277765 ttttagtccctgcaaatatgcttcgttttggttttggtccctgg 20277808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||    
21064392 ttttagtccctgcaaatatgcttcgttttggttttggtccctgg 21064435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 326 - 381
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||||||||||||||| | ||| ||||| || |||||||    
23939654 tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac 23939709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 227 - 274
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||| ||||| ||||||||||||||||||| |||||||||||||||    
24814710 aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc 24814757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24815068 - 24815013
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| | ||||||||||||| ||| ||||||||||||||||||    
24815068 ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg 24815013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25702512 - 25702567
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||||||||||||  ||||||||||||    
25702512 ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg 25702567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27117753 - 27117808
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||| ||||||||||||    
27117753 ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 27117808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28324181 - 28324126
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||| || |||||||||||||||||||    
28324181 ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg 28324126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 29992192 - 29992133
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||||||| || ||||| ||||| || |||||||| ||||    
29992192 gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt 29992133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29992300 - 29992245
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| |||||  |||||||||||||||||||||||| ||||||||||||    
29992300 ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg 29992245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 31445463 - 31445412
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||  ||||| |||||||||||| ||||||||||||||    
31445463 ggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc 31445412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32040075 - 32040130
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  | ||||||||||||||||||  |||||||||||||||||||||    
32040075 ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg 32040130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #176
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||  ||||||||||||||||||||||||||||| ||||||||    
33652193 taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt 33652240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #177
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 42430011 - 42429952
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||| ||||||||||||||||| ||||||||||| || |||||||| ||||    
42430011 gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 42429952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #178
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| |||||||||||||||||||||||||||||| ||||||||    
42430047 tttttgtccctgcaaatatgcctcgttttggttttggtccctgg 42430004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 271
Target Start/End: Original strand, 1408004 - 1408054
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag 271  Q
    |||||||||||| |||||||||| |||||||||| |||||||| |||||||    
1408004 tggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag 1408054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2355887 - 2355941
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||||| |||  ||||||||||||| ||| ||||||||||||||||||    
2355887 ggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccct 2355941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
227 aaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||| |||||  |||||||||||||| ||||||||||||||||||||||    
3680532 aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg 3680582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||  |||| |||||||||||||||| |||||||||||||||||    
5357762 gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc 5357712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttg 264  Q
    |||||||||||||||||| |||||||||||||| |||||||||    
9908918 ggctaaaatatagttttaatccctgcaaatatgtctcgttttg 9908960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 387
Target Start/End: Complemental strand, 15931155 - 15931101
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
15931155 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt 15931101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||| |||||||||| |||||||||| |||||||||||||||||||    
43727431 ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc 43727382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #186
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 387
Target Start/End: Complemental strand, 9175257 - 9175204
Alignment:
334 gaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||| || |||||||| || |||||||| ||||    
9175257 gaccccacttttgtgatgatttgcacacatggcacatgatgactgaacccattt 9175204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #187
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||  |||||||||||||| ||||||||||||||| ||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg 13779204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #188
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 258
Target Start/End: Original strand, 28398755 - 28398792
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctc 258  Q
    |||||||||||| |||||||||||||||||||||||||    
28398755 tggctaaaatatggttttagtccctgcaaatatgcctc 28398792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #189
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 29487749 - 29487802
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||||  |||| |||||||||||||||  ||||||||||||||||||    
29487749 tggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc 29487802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #190
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||||||||||||||||||| | |||||| ||||||| ||||    
43727097 ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg 43727150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 1778673 - 1778725
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||    
1778673 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaa 1778725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| |||||  |||||||||||||| ||||||||||||||||||    
2811778 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc 2811730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 388
Target Start/End: Complemental strand, 10873172 - 10873112
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
    ||||||| | ||| ||||||||||||||||| ||||||||||| || |||||||| |||||    
10873172 gtccctggctccaattttgtgatgatttgcacacgtggcacatgatgactgaacccatttt 10873112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 13154995 - 13155047
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||||||||||||||  ||||||||| ||||||||||| || ||||||    
13154995 gtccctgaccccacttttgtattgatttgcacacgtggcacatgatgactgaa 13155047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 24814814 - 24814866
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    |||||||||||||||||||| |||||||||| |||| |||||| || ||||||    
24814814 gtccctgaccccacttttgttatgatttgcacacgtagcacatgatgactgaa 24814866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 28258241 - 28258189
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||  | ||||||||||| |||||||||||||||||||    
28258241 ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc 28258189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||| |||||||||||||||||||| |||||||||    
29991918 taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc 29991966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 44997931 - 44997979
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||||  |||| ||||||||||||||||||||||||| |||||    
44997931 ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta 44997979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #199
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||    
1778917 gttttggtccctgcaaatatgtctcgttttggttttaatccctg 1778874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #200
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 4473777 - 4473820
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||||||||||||||||||||||  |||||||||| ||||||||    
4473777 ttttagtccctgcaaatatgccttattttggttttggtccctgg 4473820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #201
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4473813 - 4473872
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
4473813 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 4473872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #202
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 10540522 - 10540565
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
10540522 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 10540565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #203
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 11976627 - 11976572
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
11976627 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 11976572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #204
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 13232307 - 13232366
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
13232307 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 13232366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #205
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 241 - 276
Target Start/End: Original strand, 14847844 - 14847879
Alignment:
241 tccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||||||||| |||||||||||||||||    
14847844 tccctgcaaatatgcctcattttggttttagtccct 14847879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #206
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 326 - 381
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||| |||||||| |||||||||||| ||||| ||||| || |||||||    
17074061 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17074006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #207
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 326 - 381
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||| |||||||| |||||||||||| ||||| ||||| || |||||||    
17574209 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17574264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #208
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 23939546 - 23939597
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| ||| ||||||||||| |||||||| ||||||||    
23939546 tggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt 23939597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #209
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26530668 - 26530723
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| |||||||||| |||||||||||||| |||| |||||||| ||||    
26530668 ggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg 26530723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #210
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||| ||||| |||||||||||| || |||||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #211
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 42429758 - 42429812
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| ||||||||||||  |||||||||||||||||    
42429758 ggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg 42429812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #212
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
8298660 ttttggtccctgcaaatatgcctcattttggttttggtccctg 8298702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #213
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 10540558 - 10540600
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
10540558 gtccctggctccacttttgtgatgatttgcacacgtggcacat 10540600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #214
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 13779426 - 13779384
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    |||| |||||||||||||||||||||||||| | |||||||||    
13779426 gtccatgaccccacttttgtgatgatttgcacatgtggcacat 13779384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #215
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  |||| || ||| |||||||| ||||||||||||||||||||||    
15930933 gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg 15930987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #216
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| |||||||||||||||||| ||||||||||||    
17074095 ttttggtccctacaaatatgcctcgttttgattttagtccctg 17074053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #217
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| |||||||||||||||||| ||||||||||||    
17574175 ttttggtccctacaaatatgcctcgttttgattttagtccctg 17574217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #218
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||  ||||||||||||||||||||||    
23939620 ttttggtccctgcaaatatatctcgttttggttttagtccctg 23939662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #219
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||| | ||||||||  |||||||||||||||||||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg 30969453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 338 - 380
Target Start/End: Complemental strand, 44998146 - 44998104
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
44998146 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 44998104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #221
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
44998191 ttttggtccctgcaaatatgcctcattttggttttggtccctg 44998149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #222
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 258
Target Start/End: Complemental strand, 30969718 - 30969681
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctc 258  Q
    |||||||||||| ||||| |||||||||||||||||||    
30969718 tggctaaaatatggttttggtccctgcaaatatgcctc 30969681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 42132973 - 42133026
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| | ||||||||||||||||||||| || |||||||| || |||||||    
42132973 gtccctggctccacttttgtgatgatttgcacacctggcacatgatgactgaac 42133026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #224
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 44998264 - 44998211
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||  || || |||||||| |||||||||||||||||||    
44998264 tggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc 44998211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #225
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 331 - 387
Target Start/End: Original strand, 2355997 - 2356053
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| |||||||||||||||||||| || || ||||| || |||||||| ||||    
2355997 cctgacctcacttttgtgatgatttgcacacatgacacatgatgactgaacccattt 2356053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #226
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
245 tgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||||    
4709929 tgcaaatatgtctcgttttggttttagtccctg 4709961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #227
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 364
Target Start/End: Complemental strand, 5357654 - 5357618
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtg 364  Q
    ||||||||| ||||||||||||||||||||| |||||    
5357654 gtccctgactccacttttgtgatgatttgcacacgtg 5357618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 13796577 - 13796541
Alignment:
241 tccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||| ||| ||||||||||||||||||    
13796577 tccctgcaaatatgtctcattttggttttagtccctg 13796541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 243 - 275
Target Start/End: Complemental strand, 14848169 - 14848137
Alignment:
243 cctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||||||| ||||||||||||||||||||    
14848169 cctgcaaatatgtctcgttttggttttagtccc 14848137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #230
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 15719979 - 15719931
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||||| |||||||  ||||||||||| || ||||||||||||    
15719979 ggctaaaatataattttagtttctgcaaatatgtcttgttttggtttta 15719931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #231
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 27341258 - 27341310
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||   ||||||||||||||| |||||| |||||||||    
27341258 ggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtcc 27341310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 101; Significance: 6e-50; HSPs: 181)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 7155797 - 7155976
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
7155797 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 7155896  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7155897 tgaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 7155976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 33801743 - 33801564
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                
33801743 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttt 33801644  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33801643 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 33801564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 223 - 399
Target Start/End: Original strand, 31166871 - 31167049
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||                
31166871 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccctgcaaaattttttgttttt 31166970  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
31166971 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 31167049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 15076204 - 15076025
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
15076204 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 15076105  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
15076104 tgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 15076025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8680775 - 8680955
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
8680775 ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 8680874  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
8680875 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaattttgtagtttttgg 8680955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 221 - 398
Target Start/End: Original strand, 34582528 - 34582708
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||             
34582528 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttttgtt 34582627  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
       ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34582628 tttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 34582708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 32885673 - 32885852
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
32885673 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 32885772  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32885773 tgaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 32885852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 24692979 - 24692802
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||          |||||||||||| ||||||||            |    
24692979 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgcaaaaaaaaattgtttttggtctctgcaaaattttttgtttttg 24692880  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
24692879 aaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaattttgtagtttttgg 24692802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 30929045 - 30928867
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||          || ||||||||||| |||||||               
30929045 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt 30928946  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
     |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||    
30928945 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaattttgtagtttttg 30928867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 317812 - 317988
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |        ||||||||||||||||||||                  
317812 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg-taaaaaaaattgtttttggtccctgcaaatttttttgtttttt 317910  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
317911 aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 317988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 543724 - 543544
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||  ||||||||||||||||||||| | |||||||||||| ||||||||           |||||||||||||||||||||              
543724 ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaattttttattt 543625  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
543624 ttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaacaaattttgtagtttttgg 543544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 14655669 - 14655591
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14655669 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 14655591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 15962027 - 15962207
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||             |||||||||||||||||||||              
15962027 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 15962126  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
15962127 ttggaaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttgg 15962207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 24273939 - 24274017
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24273939 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 24274017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 225 - 398
Target Start/End: Original strand, 10091039 - 10091212
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| |||||||||||||||||||||  |||||||||||||||||||||          |||||||||||||||||||||            ||||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaa 10091138  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||    
10091139 atagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttatagtttttg 10091212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 19296408 - 19296227
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||             ||||||| |||||||| ||||             
19296408 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaagaaaattttgttttcggtccctggaaaattttttgtt 19296309  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
19296308 tttgaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaattttgtagtttttgg 19296227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 3356495 - 3356322
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaa 324  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||  |        |||||||||||||||| ||||            ||||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcccta-taaaaaaaattgtttttggtccctggaaaattttttgtttttgaaa 3356397  T
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| ||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||| ||||||||    
3356396 atagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaattttgtcgtttttgg 3356322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 778042 - 777861
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||| |||||| ||||||||||||||||||||||| ||||||||  |||||            ||||||||||||||| |||||             
778042 ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggtaaaaaaaaaaaattgtttttggtccctacaaaattttttgtt 777943  T
318 nnngaaaatagtccc-tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
       |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
777942 tttgaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 777861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 1890062 - 1890239
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||           |||||||||||||||||||||            |    
1890062 taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 1890161  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| ||||||||||| ||||||||||    
1890162 aaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatagtttttgg 1890239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 494661 - 494583
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||    
494661 gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaatcaattttgtagtttttgg 494583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 2616134 - 2616056
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
2616134 gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 2616056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 398
Target Start/End: Complemental strand, 7324189 - 7324015
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||||||||             |||||||||||||||||||||                 
7324189 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattgtttttt-- 7324092  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||    
7324091 aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaattttgtagtttttg 7324015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 15116773 - 15116851
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
15116773 gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 15116851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17321453 - 17321375
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||    
17321453 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttgg 17321375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17321586 - 17321508
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||    
17321586 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatagtatttgg 17321508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 391
Target Start/End: Complemental strand, 31398440 - 31398370
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgta 391  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
31398440 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgta 31398370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 398
Target Start/End: Original strand, 11129302 - 11129379
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||    
11129302 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaattttttagtttttg 11129379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 224 - 398
Target Start/End: Complemental strand, 6591440 - 6591263
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||| |||||||| |||||||||||| |||||||||||||||||  |||||           |||||||||||||||||||||                
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 6591341  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
     |||||||| |||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||    
6591340 taaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttg 6591263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 26375693 - 26375871
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||| ||||||           ||||||||| |||||||||||                
26375693 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaattgtttttgttccctgcaaaattttttgttttt 26375792  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||    
26375793 taaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttgg 26375871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 6468570 - 6468493
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||    
6468570 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaattttgtagtttttgg 6468493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 19276036 - 19275862
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    ||||||||||||||||||||| ||||||| |||| ||||||||||||||||||            |||||||||||||||||||||             |    
19276036 taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttgtttttt--a 19275939  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
19275938 aaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg 19275862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 21995167 - 21995244
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
21995167 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg 21995244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 242 - 399
Target Start/End: Original strand, 5286606 - 5286768
Alignment:
242 ccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgacccc 339  Q
    ||||||||||||||||||||||| ||||||||| ||||          |||||||||||||||||||||            |||||||||||||| ||||    
5286606 ccctgcaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattatttgtttttgaaaatagtccctggcccc 5286705  T
340 acttttgtgatgatttgcatacgt---ggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||| ||   |||||||||||| |||||||||||||||||||||||    
5286706 acttttgtgatgatttgcatatgtggcggcacattataaatgaaccaattttgtagtttttgg 5286768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 223 - 389
Target Start/End: Original strand, 14428651 - 14428818
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||| |||||||||| |||||||||||||||||||||||||||||||||           ||||||||||||||||||||                  
14428651 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttt 14428750  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 389  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||    
14428751 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttg 14428818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 7156160 - 7156103
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
7156160 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 7156103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 24274131 - 24274074
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
24274131 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 24274074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 15962390 - 15962334
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
15962390 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15962334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 12612359 - 12612179
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| || ||||||||||||||||||||||||||| |||||||||||||             ||||||||||||| |||||||              
12612359 ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccttgcaaaattttttgttt 12612260  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||| ||| | ||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
12612259 tttaaaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 12612179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 494404 - 494457
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||    
494404 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 494457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 226 - 279
Target Start/End: Original strand, 543365 - 543418
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 543418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 1890452 - 1890395
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||    
1890452 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt 1890395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 2373391 - 2373314
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||| | ||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||    
2373391 aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttgg 2373314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 8681116 - 8681059
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
8681116 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 8681059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 12419938 - 12419881
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
12419938 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt 12419881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 14655379 - 14655436
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||    
14655379 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt 14655436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 22822651 - 22822594
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||    
22822651 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt 22822594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 33131626 - 33131703
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||| | ||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||    
33131626 aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttgtagtttttgg 33131703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||    
20467354 taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 20467406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26375990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1007509 - 1007454
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
1007509 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1007454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3414387 - 3414442
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
3414387 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3414442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3969009 - 3968954
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
3969009 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3968954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt 5286894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 11448537 - 11448720
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc--tggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||  |||||||||||||||||||| ||||||||||||||||||||  |           |||||||||||||||||||||               
11448537 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 11448636  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgca----tacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||   |||||| |||||||||||||||||||    |||||| ||||||||||||||| ||||||||||||||||||    
11448637 tgaaaatagtttgtgaccctacttttgtgatgatttgcatacgtacgtgacacattataactgaatcaattttgtagtttttgg 11448720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21994403 - 21994348
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
21994403 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 21994348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21995064 - 21995119
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||    
21995064 ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg 21995119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22543354 - 22543409
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
22543354 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22543409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25137357 - 25137302
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
25137357 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25137302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25431854 - 25431799
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
25431854 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 25431799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30928681 - 30928736
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
30928681 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 30928736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34582892 - 34582837
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
34582892 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg 34582837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2615872 - 2615926
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||    
2615872 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 2615926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
23770162 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 23770216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 31167201 - 31167143
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||    
31167201 tggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt 31167143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9896637 - 9896460
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| || |||||||||||||||| ||          ||||||||| ||||||||| |                 
9896637 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtgaaaaaaatttgtttttgctccctgcaagattttttgtttttt 9896538  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| | || |||| |||| ||||||||||||||||||||| || || |||||||| ||||||||||||||||    
9896537 aaaatagtcaccgatcccatttttatgatgatttgcatacgtggcatatgatgactgaacccattttgtagtttttgg 9896460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 17771910 - 17771963
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| |||||||||||||||||||||| ||||||||||||||||||    
17771910 tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc 17771963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 22792899 - 22792846
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||    
22792899 ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc 22792846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 33808620 - 33808677
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||    
33808620 ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt 33808677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 3356142 - 3356194
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||||||    
3356142 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc 3356194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
12176640 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 12176588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 12419708 - 12419760
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||||||||    
12419708 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 12419760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 21995426 - 21995370
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||    
21995426 tggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg 21995370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||||||||||||||||||| |||||||||||||||||||||    
34990312 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 34990260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1007124 - 1007179
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
1007124 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 1007179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2373179 - 2373234
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||    
2373179 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg 2373234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3968645 - 3968700
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
3968645 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3968700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6412218 - 6412273
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
6412218 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 6412273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6412579 - 6412524
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
6412579 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 6412524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6468310 - 6468365
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||| | |||||||||||||||||||    
6468310 ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg 6468365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10910964 - 10910909
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
10910964 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 10910909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11449169 - 11449114
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||    
11449169 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg 11449114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12299140 - 12299085
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||    
12299140 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 12299085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19690393 - 19690448
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
19690393 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19690448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20467718 - 20467663
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||    
20467718 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 20467663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21147404 - 21147459
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
21147404 ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg 21147459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21385251 - 21385306
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
21385251 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 21385306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 21385584 - 21385529
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
21385584 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 21385529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 22543718 - 22543663
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
22543718 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 22543663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23502540 - 23502485
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||    
23502540 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg 23502485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24273828 - 24273883
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||    
24273828 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg 24273883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25136994 - 25137049
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
25136994 ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg 25137049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
31198615 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 31198670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 33131850 - 33131795
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||  |||||||||||||||||||||||||||||||||    
33131850 ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg 33131795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 13268109 - 13268163
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||    
13268109 ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct 13268163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 19321131 - 19321081
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||||||    
19321131 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 19321081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 777677 - 777734
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||  ||||||| ||||||||||| |||||||||||||||||||||||||    
777677 ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt 777734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 13617584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 23770400 - 23770343
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||    
23770400 ttttgtgatgatttgcatacgtggcacgtgatgactgaacccattttgtagtttttgg 23770343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3276354 - 3276302
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
3276354 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 3276302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 369
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 369  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||||    
17772014 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca 17772062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 19129336 - 19129392
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||| ||||| | ||| |||||||||||||||||||||||||||||||||||||||    
19129336 ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg 19129392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 19267564 - 19267620
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||| |||||||| |||||||||||||||||||||    
19267564 tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg 19267620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 355 - 399
Target Start/End: Original strand, 22822391 - 22822435
Alignment:
355 tgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||| ||||||||||||||||||||||||||||||||||||||||    
22822391 tgcaaacgtggcacattataactgaaccaattttgtagtttttgg 22822435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 24901238 - 24901290
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
24901238 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 24901290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31186592 - 31186536
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| || ||||||||||||||||||||| |||||||||||||    
31186592 tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg 31186536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 318097 - 318042
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| ||||||||||||||  |||||||||||||||||||||    
318097 ggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg 318042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 494751 - 494700
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||||| |||    
494751 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatcc 494700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1875502 - 1875557
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||| |||| ||||||||||||||||||||||||| ||| |||||||    
1875502 ggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg 1875557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 2616240 - 2616193
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||    
2616240 ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3414752 - 3414697
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||||    
3414752 ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 3414697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 6591115 - 6591162
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||    
6591115 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt 6591162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 8170151 - 8170100
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
8170151 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 8170100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 12757610 - 12757661
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
12757610 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 12757661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
13617804 gttttggtccctgcaaatatgcctcgttttggttttagtccctg 13617761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 14656260 - 14656205
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| |||||||||| ||||||||||||||||||||||    
14656260 ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 14656205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18024375 - 18024320
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| || |||||||||||||||||||    
18024375 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 18024320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19296108 - 19296163
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| || |||||||||||||||||||||| |||||||| ||||||||||||    
19296108 ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg 19296163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21993787 - 21993842
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
21993787 ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg 21993842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||    
23502237 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 24901347 - 24901406
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||| ||||    
24901347 gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacccattt 24901406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 30239292 - 30239347
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||||  ||||||| |||||||||||| |||||||||||||||||||||    
30239292 tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct 30239347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||  |||||||||||||||||||||||||||||| |||||||||    
34989962 gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc 34990013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||| |||||||||| ||||||||||| ||||||||||||||||||    
14428948 ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc 14428898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 17765009 - 17765059
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||    
17765009 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 17765059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 22822307 - 22822357
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||||||| |||||||||| ||||||||||||||||||    
22822307 ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 353 - 399
Target Start/End: Original strand, 25431672 - 25431718
Alignment:
353 tttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| |||||||||||| |||||||||||||||||||||    
25431672 tttgcatacgtgacacattataactaaaccaattttgtagtttttgg 25431718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| || | |||||||||||||||||||||||||||||||||    
30479421 gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg 30479367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 31276339 - 31276285
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||| ||||||||||||||| ||||||||| ||||||||||||    
31276339 gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg 31276285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 13617648 - 13617697
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| ||||||||||| ||||    
13617648 ccacttttgtgatgatttgcacacgtggcacatgataactgaacccattt 13617697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 263
Target Start/End: Complemental strand, 23770439 - 23770398
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgtttt 263  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
23770439 ggctaaaatatggttttagtccctgcaaatatgcctcgtttt 23770398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 10910628 - 10910684
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||| || |||||||| ||||||||||||||||||||||    
10910628 tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg 10910684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 269
Target Start/End: Complemental strand, 11129544 - 11129496
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||||  ||||| |||||||||||||||||||||||||||||    
11129544 tggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt 11129496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||  |||||||||||||||||||||||||||||||||    
18024014 taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg 18024066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 31398541 - 31398489
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||||||||||||||||||| ||| |||||||||||||||    
31398541 ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc 31398489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| ||||| ||||||||||||||| |||||||| ||||||||||||    
12298825 taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct 12298876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 12298927 - 12298986
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| ||||||||||| || | |||||| ||||    
12298927 gtccctggccccacttttgtgatgatttgcacacgtggcacatgatgattgaacccattt 12298986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13150750 - 13150695
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| || |||  ||||||||||||| ||||||||||||||||||||||    
13150750 ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg 13150695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 15442936 - 15442987
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| |||||||||||||| |||||||||| |||||||    
15442936 tggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt 15442987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19129520 - 19129465
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||| | ||||||||||||||||||||    
19129520 ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg 19129465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 19320876 - 19320935
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
19320876 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 19320935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25121496 - 25121441
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || ||||||||||||  |||||||||||||||||||||    
25121496 ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg 25121441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 31198724 - 31198783
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
31198724 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 31198783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 1214696 - 1214750
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| ||||||||||||||| | | |||||||||||||||||    
1214696 ggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct 1214750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 1214996 - 1214942
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||  || ||||||||||| |||||||||||||||||||||    
1214996 ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct 1214942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||| |||||||||||||||||||||    
6564595 ttttggtccctgcaaatatgtctcgttttggttttagtccct 6564636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||| |||||||||||||| ||| |||| |||||||||||||    
9896280 ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg 9896333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 365
Target Start/End: Original strand, 13268218 - 13268255
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtgg 365  Q
    ||||||||||||||||||||||||||||||| ||||||    
13268218 gtccctgaccccacttttgtgatgatttgcacacgtgg 13268255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||| ||| ||||||||||| ||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg 19320822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 366 - 399
Target Start/End: Complemental strand, 33808837 - 33808804
Alignment:
366 cacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||    
33808837 cacattataactgaaccaattttgtagtttttgg 33808804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 258
Target Start/End: Complemental strand, 15117040 - 15117004
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctc 258  Q
    ||||||||||| |||||||||||||||||||||||||    
15117040 ggctaaaatatggttttagtccctgcaaatatgcctc 15117004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 235 - 279
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||| ||||||||||||||| |||||||||||||||||| |||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagtctctggt 19275179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 1007197 - 1007240
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
1007197 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 1007240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 1214767 - 1214810
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||| || ||||||||||||||||||||    
1214767 ttttggtccctgcaaatatgtcttgttttggttttagtccctgg 1214810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 3968754 - 3968809
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
3968754 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 3968809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 273
Target Start/End: Complemental strand, 6564932 - 6564893
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||| ||||||||||||||| ||||||||||||||||||    
6564932 gttttggtccctgcaaatatgtctcgttttggttttagtc 6564893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 12611994 - 12612045
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| || ||||||||||||||||||||  ||||| ||||||||    
12611994 tggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt 12612045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 14655903 - 14655958
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| || ||||| ||||||||||||||   |||||||||||||||||||||    
14655903 ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg 14655958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 15116673 - 15116721
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||||||| ||||||||||  |||||||||||||||||    
15116673 ggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagt 15116721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 15722610 - 15722665
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||  |||||||||| ||||||||| ||||||||||||    
15722610 ggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg 15722665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 15722719 - 15722778
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||| |||||||||||| |||| ||||||| ||||| ||||| ||||||||||| ||||    
15722719 gtccccgaccccacttttatgatcatttgcacacgtgacacatgataactgaacccattt 15722778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 15722900 - 15722849
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||  | ||||||||||||||| || ||||||||||||    
15722900 ggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtc 15722849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17765375 - 17765320
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||| ||||||||  ||||||||||||    
17765375 ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg 17765320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 379
Target Start/End: Complemental strand, 25121388 - 25121337
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 379  Q
    ||||||| ||||||||||||||||||||||| ||||| ||||| || |||||    
25121388 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactga 25121337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 25137066 - 25137109
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
25137066 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 25137109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 338 - 381
Target Start/End: Original strand, 31185753 - 31185796
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
31185753 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 31185796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 31198688 - 31198731
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
31198688 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 31198731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
13268182 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 13268224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
19129447 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 19129405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||| ||||| ||||||||||||||   |||||||||||||||||    
23628799 gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc 23628849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 387
Target Start/End: Complemental strand, 23629044 - 23628994
Alignment:
337 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||| | ||||||||||| || |||||||| ||||    
23629044 cccacttttgtgatgatttgtacacgtggcacatgatgactgaacccattt 23628994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
24901311 ttttggtccctgcaaatatgcctcattttggttttggtccctg 24901353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 25137102 - 25137144
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
25137102 gtccctggctccacttttgtgatgatttgcacacgtggcacat 25137144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 1214801 - 1214862
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| | | ||||||||||||||||||| ||||| ||||| || |||||||| ||||    
1214801 tagtccctggctctacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 1214862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12176384 - 12176437
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||||| || || ||||||| |||||||| ||||||||||    
12176384 tggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtcc 12176437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||||||| |||||||||| ||||||    
17765302 ttttggtccctgcaaatatgcctcattttggttttggtccct 17765261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 19690760 - 19690708
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||| ||||||| ||||| ||||||||||||||| |||||||| ||||||||||    
19690760 tggcgaaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc 19690708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 34990213 - 34990136
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||| |||| ||||||||||||||||| || |||||||| || | |||||  ||||  ||||||||||    
34990213 aaaatagtccttgatcccatttttgtgatgatttgcaaacatggcacatgatgattgaactgatttattagtttttgg 34990136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 277
Target Start/End: Original strand, 7323891 - 7323923
Alignment:
245 tgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||||    
7323891 tgcaaatatgtctcgttttggttttagtccctg 7323923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 11925738 - 11925790
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||| ||||  |||| ||||||||||||||| ||||||||| ||||||||    
11925738 tggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtc 11925790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 223 - 267
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggtt 267  Q
    |||||||||| |||||||||||| |||||||| ||| ||||||||    
27764914 gctaaaatatggttttagtccctacaaatatgtctcattttggtt 27764958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||| ||||| |||||| |||||||||||| |||||||||| |||||||    
31276105 taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg 31276157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 213)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 18633962 - 18633781
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||           |||||||||||||||||||||             
18633962 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 18633863  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18633862 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 18633781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 36577722 - 36577899
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||          |||||||||| ||||||||||            |    
36577722 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggcccctgcaaaattttttgtttttg 36577821  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36577822 aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 36577899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 6118500 - 6118315
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-------ttgtttttggtccctgcaaaannnnn 313  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||               |||||||||||||||||||||         
6118500 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttt 6118401  T
314 nnnnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6118400 tgtttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 6118315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 28550826 - 28551005
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |         ||||||||||||| |||||||               
28550826 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaattgtttttggtccttgcaaaattttttgtttt 28550925  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
28550926 tgaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttgg 28551005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 223 - 397
Target Start/End: Original strand, 29172524 - 29172701
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||| |||||||               
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtttt 29172623  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
     |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29172624 tgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagttttt 29172701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35166158 - 35165980
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||| ||||| ||||||||||||||||| ||| ||||||||||||||||||||||||         || ||||||||||||||||||                
35166158 ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaaaaaaaattatttttggtccctgcaaaattttttgttttt 35166059  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35166058 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 35165980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 5950176 - 5950352
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |         ||||||||||||||||||||            |    
5950176 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaaatgtttttggtccctgcaaaattttttgtttttg 5950274  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5950275 aaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaattttgtagtttttgg 5950352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 15635379 - 15635555
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt--tgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||| |||||||||| |||||||||| || |||||||||||||||||||||        |  ||||||||||||||||||||            ||    
15635379 taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataatgtttttggtccctgcaaaattttttgtttttga 15635478  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15635479 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 15635555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35167165 - 35166986
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||| |||||||               
35167165 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaatttgtttttggtccttgcaaaaatttttgtttt 35167066  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35167065 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 35166986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5614530 - 5614350
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||             |||||||||||||||||||||              
5614530 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt 5614431  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5614430 ttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 5614350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 42026892 - 42027007
Alignment:
99 gtttgtgattgttcataatgaagatnnnnnnn-tggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaata 197  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42026892 gtttgtgattgttcataatgaagataaaaaaaatggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaata 42026991  T
198 tcttacgttatgtaat 213  Q
    ||||||||||||||||    
42026992 tcttacgttatgtaat 42027007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 29693090 - 29692913
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||||||  ||||||||||||||||||||| |||||||||||||||||| ||          ||||||||||||||| |||||            |    
29693090 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaattgtttttggtccctacaaaattttttgtttttg 29692991  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
29692990 aaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 29692913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 29151515 - 29151696
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||           ||||||||||| |||| ||||             
29151515 tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaattttttgtt 29151614  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
29151615 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 29151696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 2217854 - 2217678
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||| ||||                
2217854 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgtaaaattttgttttt-- 2217757  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
2217756 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttttagtttttgg 2217678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 42207242 - 42207419
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||| || ||||||| ||||||||||||||||||||||           |||||||||||||||||||||                
42207242 ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 42207341  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
42207342 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttg 42207419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 29875400 - 29875579
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||  ||||| |||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||                
29875400 ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaatttttttgtttt 29875499  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
29875500 tgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaattttctagtttttgg 29875579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 30800850 - 30800672
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          || |||||||||||||||||||                
30800850 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattttttttttgtttttggtccctgcaaaattttttgttttt 30800751  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||  ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||    
30800750 gaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaattttgaagtttttgg 30800672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 30888160 - 30888340
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||          ||   |||||||||||||||||||              
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttgttt 30888259  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
30888260 ttgaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaattttgtagtttttgg 30888340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 23382297 - 23382130
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||||   ||          |||||||||||||||||||            |    
23382297 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct--gtaa--------gtttttggtccctgcaaaattttttgtttttg 23382208  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
23382207 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 23382130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 16616463 - 16616541
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16616463 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 16616541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 21050575 - 21050753
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||  ||||||||||| ||||||||| |||||||| ||||||||||||           |||||||||||||||||||||                
21050575 ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 21050674  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21050675 gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 21050753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 27850275 - 27850197
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
27850275 gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaattttgtagtttttgg 27850197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 38962992 - 38962914
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
38962992 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 38962914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 4203456 - 4203632
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||  |        ||||||||||||  |||||||            |    
4203456 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgccta-taaaaaaaattgtttttggtctgtgcaaaatttcttgtttttg 4203554  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||| |||||||    
4203555 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaattttgtaatttttgg 4203632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10408928 - 10409110
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn------ttgtttttggtccctgcaaaannnnnnn 315  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||              ||||||||| |||||||||||           
10408928 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaaaaattgtttttgatccctgcaaaattttttg 10409027  T
316 nnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
         |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
10409028 tttttgaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaattttgtagtttttgg 10409110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 224 - 399
Target Start/End: Complemental strand, 16038738 - 16038560
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||| |||             |||||||||||||||||||||                
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 16038639  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
16038638 gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 16038560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 294091 - 294013
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
294091 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 294013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 38786159 - 38786336
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||           |||||||||||||||||||||                
38786159 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 38786258  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||    
38786259 gaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacc-attttgtagtttttgg 38786336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 33336027 - 33335845
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn 316  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||              |||||||||||| ||||||||            
33336027 tggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtcgctgcaaaattttttgt 33335928  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        ||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||    
33335927 ttttgaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaatcaattttgtagtttttgg 33335845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 7075860 - 7075782
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7075860 gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 7075782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 25779060 - 25778982
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||    
25779060 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttatagtttttgg 25778982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 31037497 - 31037575
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
31037497 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 31037575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 37090640 - 37090562
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||    
37090640 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttgtagtttttgg 37090562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 38496521 - 38496599
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
38496521 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagtttttgg 38496599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 25561704 - 25561887
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt---nnnnnnnnttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||           |||||||||||||||||||||             
25561704 tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 25561803  T
318 nnngaaaat-agtccctgacccca-cttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||| |||| ||||||||| |||||||||||||||||||| || ||||||||||||||||  |||||||||||||||||    
25561804 tttgaaaataagtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaataaattttgtagtttttgg 25561887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 323 - 399
Target Start/End: Complemental strand, 21125170 - 21125094
Alignment:
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||    
21125170 aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 21125094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 28863839 - 28863656
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnt------tgtttttggtccctgcaaaannnnnn 314  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          |      ||||||||||||||||||||          
28863839 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaatttttt 28863740  T
315 nnnnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
           ||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||    
28863739 gttttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaaccgattttgtagtttttg 28863656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 34125307 - 34125484
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||           |||||||||||||||||||||                
34125307 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgttttt 34125406  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||| |||| |||| |||| |||||||||||||||||||||||| || |||||||| ||||||||||||||||    
34125407 taaaatagtctctga-cccatttttttgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 34125484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 39379330 - 39379408
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||| || ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
39379330 gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 39379408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 40029141 - 40029316
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||| ||||||| ||||||||||||||| ||||||          |||||||| ||||||| ||||            |    
40029141 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaaaaaaaaattgtttttcgtccctgtaaaattttttgtttttg 40029240  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||||| || |||||||||||||||||   ||||||| ||||||||||||||||||||||||||||||||    
40029241 aaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaattttgtagttttt 40029316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 18046250 - 18046172
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||| ||||    
18046250 gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaattttatagttcttgg 18046172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 3850525 - 3850448
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
3850525 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 3850448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 24782274 - 24782099
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||| | |||||||||||||||||| ||||||||||||           |||||||||||||||||||||                
24782274 ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaattgtttttggtccctgcaaaattttttgttttt 24782176  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||| |||||||  || ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||    
24782175 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttt 24782099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 10744054 - 10743876
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||          || ||||||||||||| ||||                 
10744054 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtccctacaaatttttttgttttt 10743955  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||||| ||||||||||||||||    
10743954 taaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaaccgattttgtagtttttgg 10743876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 321 - 398
Target Start/End: Complemental strand, 14318300 - 14318223
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||||||||||| | ||||||||||||||||||||||| ||||| || |||||||| |||||||||||||||    
14318300 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacccattttgtagtttttg 14318223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 18633599 - 18633656
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
18633599 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 18633656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 27916564 - 27916641
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||| ||||||||||||| || || || |||||||||||||||||||||||||    
27916564 aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaattttgtagtttttgg 27916641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29172886 - 29172829
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29172886 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 29172829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29875725 - 29875668
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29875725 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 29875668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40029498 - 40029442
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
40029498 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 40029442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 2217494 - 2217549
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
2217494 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 2217549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 7075572 - 7075627
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
7075572 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7075627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28863510 - 28863565
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28863510 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28863565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29692744 - 29692799
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
29692744 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29692799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30800494 - 30800549
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
30800494 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 30800549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36578083 - 36578028
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
36578083 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 36578028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 325 - 399
Target Start/End: Complemental strand, 3850719 - 3850645
Alignment:
325 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| ||||||||| || |||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
3850719 atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 3850645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 15635707 - 15635650
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
15635707 ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt 15635650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 29366950 - 29366770
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||   |        | |||||||||||||||||||              
29366950 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaattttttttatagtttttggtccctgcaaaattttttgttt 29366851  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||| |||||||||||| |||||||||||||| |||||||| ||||| || | |||||| ||||| ||||||||||    
29366850 tttaaaataatccctgaccccatttttgtgatgatttacatacgtgacacatgatgattgaacctattttatagtttttgg 29366770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 6912496 - 6912552
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
6912496 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 6912552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 10743724 - 10743776
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
10743724 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 10743776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 16038377 - 16038429
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
16038377 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 16038429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18046348 - 18046296
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
18046348 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 18046296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26133182 - 26133238
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
26133182 tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 26133238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1105148 - 1105093
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
1105148 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1105093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1381611 - 1381556
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
1381611 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1381556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5917460 - 5917405
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
5917460 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5917405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11799458 - 11799403
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
11799458 ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg 11799403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 13990708 - 13990783
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||| |||||| | ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||    
13990708 aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacatgatgactcaacccattttgtagttttt 13990783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19565831 - 19565776
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
19565831 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19565776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19685380 - 19685325
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
19685380 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19685325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 24443744 - 24443689
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
24443744 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 24443689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26133413 - 26133358
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
26133413 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 26133358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35928064 - 35928119
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
35928064 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35928119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 38170514 - 38170569
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
38170514 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38170569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40167786 - 40167841
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||    
40167786 ggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 40167841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40764415 - 40764470
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
40764415 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 40764470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9179920 - 9179743
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||           |||||||||||||||||||||                
9179920 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaaaaaaaaattgtttttggtccctgcaaaaattttgtttttt 9179821  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||| | ||||||| | |||||||||||||| |||||||||||| ||||| ||||| ||||| ||||||||||    
9179820 -aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacctattttatagtttttgg 9179743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
39379242 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt 39379296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 10409326 - 10409269
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||    
10409326 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggt 10409269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 25561999 - 25561942
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||    
25561999 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggt 25561942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 29151851 - 29151794
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||    
29151851 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt 29151794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 38496782 - 38496725
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||  |||||||||||||||||||||||    
38496782 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt 38496725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 39379610 - 39379553
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||    
39379610 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt 39379553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 45137 - 45193
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
45137 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 293828 - 293880
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||||||||||||| |||||||||    
293828 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc 293880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13990895 - 13990843
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||    
13990895 ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc 13990843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 20660948 - 20661000
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
20660948 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 20661000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
20985728 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20985780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 21050914 - 21050858
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||    
21050914 tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg 21050858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 35928459 - 35928403
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35928459 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35928403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1104858 - 1104913
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
1104858 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 1104913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1381247 - 1381302
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
1381247 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1381302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||| |||||||||||||||||||||||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 2636941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3850599 - 3850544
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||    
3850599 ggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 3850544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4203770 - 4203715
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
4203770 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 4203715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5917126 - 5917181
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
5917126 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 5917181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 11799129 - 11799184
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||| | |||||||||||||||||||    
11799129 ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg 11799184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18046038 - 18046093
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
18046038 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 18046093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19565467 - 19565522
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
19565467 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19565522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 19685017 - 19685072
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
19685017 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19685072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20986089 - 20986034
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||    
20986089 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 20986034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21124913 - 21124968
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||    
21124913 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 21124968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24443380 - 24443435
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
24443380 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 24443435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24781989 - 24782044
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||    
24781989 ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg 24782044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 34125632 - 34125577
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||    
34125632 ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg 34125577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35876688 - 35876743
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
35876688 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 35876743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 37271359 - 37271414
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
37271359 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 37271414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40168008 - 40167953
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||    
40168008 ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg 40167953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40764780 - 40764725
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
40764780 ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg 40764725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 22551214 - 22551144
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||||||||||||||||||||||||||||  ||||||||||| |||| || |||||||  |||||||||    
22551214 aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaactcattttgtag 22551144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 3850298 - 3850355
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttgg-ttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||    
3850298 tggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg 3850355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 6912802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| |||||||||| ||||||||||||||||||||||||||||||    
9532532 taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc 9532483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 271
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag 271  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||    
35166911 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||| ||| ||||||||||||||||||||| |||||||||||||||||||    
2032940 ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc 2032888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 5614166 - 5614218
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||    
5614166 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 5614218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14318045 - 14318097
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||| |||||||||| |||||||||||||||||||    
14318045 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc 14318097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18258527 - 18258475
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
18258527 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 18258475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20661312 - 20661256
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||| ||||||||||| |||||||||||||||||||||    
20661312 tggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg 20661256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||    
27916761 taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc 27916713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||||| |||||||||||||||||||||||||||||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg 28108107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28213373 - 28213425
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||||||| |||||||||||||||    
28213373 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc 28213425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 31037741 - 31037693
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||    
31037741 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 31602264 - 31602320
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||||| ||||||||||| |||| |||||| |||||||||    
31602264 ccccacttttgtgatgatttgcacacgtggcacatgataattgaacccattttgtag 31602320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 35609302 - 35609358
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||| ||||||||||| |||||||||||||||||||||    
35609302 tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg 35609358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| || || |||||| |||||||||||||||||||||||||||||||    
1286682 ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg 1286737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 4736542 - 4736487
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||  |||||||||||||||||||||    
4736542 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 4736487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9179593 - 9179648
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| ||||||||||  |||||||||||||||||||||    
9179593 ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg 9179648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12144907 - 12144962
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||||||| ||||||||||||||||||    
12144907 ggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg 12144962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 18258162 - 18258217
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||    
18258162 ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg 18258217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 20683747 - 20683802
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| |||||||||||| |||||||| ||||||||||||    
20683747 ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg 20683802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 20690733 - 20690784
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
20690733 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 20690784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 23381950 - 23382005
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| || |||||||||||||| ||||    
23381950 ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg 23382005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25779162 - 25779107
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||| || ||||||||||||| ||||    
25779162 ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg 25779107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26071291 - 26071346
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||  ||||||||||||||| ||| ||||||||||||||||||    
26071291 ggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg 26071346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28871994 - 28871939
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| ||| ||||| ||||||||||||||||||||||||||||||||| ||||    
28871994 ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 28871939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35877052 - 35876997
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||| |||||    
35877052 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg 35876997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37271706 - 37271651
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||| ||||||||||||    
37271706 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 37271651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 38962805 - 38962856
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||||||||||| ||||||| |||||||||||||||||    
38962805 tggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt 38962856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 330 - 392
Target Start/End: Original strand, 17070646 - 17070708
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||||||||||| ||||||||||| || | |||| | |||||||||    
17070646 ccctgaccccacttttgtgatgatttgcacacgtggcacatgatgaatgaatccattttgtag 17070708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 18286741 - 18286691
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||| || |||||||||||||||||||| ||||||||||||||||||    
18286741 ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt 18286691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
20690840 gtccctgaccccacttttgtgatgatttgcatacatggcacat 20690882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| ||||||||||||||||||||||||| |||| |||||||||    
16616370 ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc 16616419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||| ||||||||||||||||||||||||||| |||| |||||| || |||||||| ||||    
26071397 tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt 26071458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||||||| | |||||||||||||||||||||||||||||||    
42207570 ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg 42207518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 42994067 - 42994116
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||||| ||||||||||||||||||||| ||||||||| |||||    
42994067 tggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta 42994116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 2636668 - 2636720
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||| ||||| ||||||||||||| | ||||||||||||||||||    
2636668 tggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc 2636720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 321 - 397
Target Start/End: Original strand, 9532291 - 9532367
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    ||||||||| | || ||||| ||||||||||||||||||||||| ||||| |  || ||||| ||||||||||||||    
9532291 gaaaatagttcttggccccatttttgtgatgatttgcatacgtgacacatgacgaccgaacccattttgtagttttt 9532367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||  |||||||| ||||||||||| |||||||||||||||||||||    
27850372 ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct 27850320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||| ||||| ||||||||||||||| |||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35609587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 40038859 - 40038803
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| |||||||||||||||||| |||||||||||| ||||||    
40038859 tggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg 40038803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 42553641 - 42553693
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||||  |||| ||||||||||||||| ||||||||||||||||||    
42553641 tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 42553693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| |||||||| |||||||||||||    
42596814 taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg 42596762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 3851329 - 3851274
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||  ||||||| ||||||||| ||||||||||||    
3851329 ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg 3851274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 4736433 - 4736374
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| |||||||||||||||| |||| ||||||||||| || |||||||| ||||    
4736433 gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacccattt 4736374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5904008 - 5904063
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||| |||||||||||||||||||| ||||||||||||    
5904008 ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg 5904063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 5904260 - 5904205
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||| |||||||||||||||||||||||||| || || ||||||||||| ||||    
5904260 ctgacctcacttttgtgatgatttgcatacgtgacatatgataactgaacccattt 5904205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 279
Target Start/End: Original strand, 6118139 - 6118190
Alignment:
229 atatagttttagtccctgcaaatatgcctcgtttt-ggttttagtccctggt 279  Q
    |||| ||||||||| |||||||||||||||||||| ||||||||||||||||    
6118139 atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt 6118190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 10830638 - 10830697
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| ||||| ||||  || |||||||| ||||    
10830638 gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt 10830697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 11935861 - 11935802
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||| ||||| |||||||||||| |||||| |||| |||||| |||||||||    
11935861 gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaattt 11935802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Original strand, 15916285 - 15916340
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||| || ||||| ||||||||||||||| ||| |||||||||||||||||    
15916285 tggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct 15916340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 17070863 - 17070808
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||| |||||||| |||||||| ||||||| |||||    
17070863 ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg 17070808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| ||||| |||||||||||||| ||||||||| |||||||||||||    
32888691 aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg 32888742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||| ||||||||| ||||||||||||    
36973710 ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg 36973655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||| ||||||||||||| ||||||| ||||||||||| || |||||||||    
37271597 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca 37271542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40038604 - 40038663
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40038604 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt 40038663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||||||||||||||||||||||||||| ||||| |||||    
20661057 gtccctgaccccacttttgtgatgatttgcacacgtgacacat 20661099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 38555083 - 38555030
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||  ||||||||||||||||||| |||||||||||||||||    
38555083 ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct 38555030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #170
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 11799205 - 11799279
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| || ||||||||||||||| ||||    ||||| |||||| |||  ||||||||||||||||||||||    
11799205 gaaaatagtccttggccccacttttgtgataattt----acgtgacacattttaaaagaaccaattttgtagtttttgg 11799279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #171
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 20416360 - 20416413
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||||| ||||||||||||||| |||| |||||||| ||||||    
20416360 ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc 20416413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #172
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 31037397 - 31037446
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| |||||||||||||||||||| ||| |||||| ||||||||    
31037397 ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtc 31037446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #173
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 222 - 267
Target Start/End: Original strand, 31602143 - 31602188
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtt 267  Q
    |||||||||||||||||  ||||||||||||||| |||||||||||    
31602143 ggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt 31602188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #174
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 32108926 - 32108975
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
32108926 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 32108975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 9588611 - 9588559
Alignment:
223 gctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| | |||| ||||||||||||||| |||||||||||||||||||    
9588611 gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc 9588559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 26071597 - 26071561
Alignment:
241 tccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||| ||||||||||||||||||||||    
26071597 tccctgcaaatatgtctcgttttggttttagtccctg 26071561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||  |||| |||||||||||||| | |||||||||||||||||||||    
28871640 taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg 28871692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 40038494 - 40038542
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| |||||  |||||||||||||||||||||||| |||||    
40038494 ggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta 40038542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 1105075 - 1105032
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
1105075 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 1105032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 1286938 - 1286879
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| |||||||||||||||||||||||  |||| ||||| || |||||||| ||||    
1286938 gtccctgtccccacttttgtgatgatttgcaagcgtgacacataatgactgaacccattt 1286879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 2636778 - 2636837
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||| ||||    
2636778 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaacccattt 2636837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 5104002 - 5103951
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| || |||||||||||| ||| |||||||||||||    
5104002 tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt 5103951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 9588499 - 9588444
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||| ||||||||||||| |||| |||||||||||||| || |||||||| ||||    
9588499 ctgactccacttttgtgataatttacatacgtggcacatgatgactgaacccattt 9588444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 10830529 - 10830584
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| || ||||||||||| |||||||||||||| ||||    
10830529 ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg 10830584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17070535 - 17070589
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||| |||| ||||||||||||    
17070535 ggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg 17070589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 322 - 381
Target Start/End: Original strand, 18286530 - 18286589
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||| ||| ||||| |||||||||||||| ||||||||||| || || |||||||    
18286530 aaaatagtctctggccccagttttgtgatgatttacatacgtggcatatgatgactgaac 18286589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 19685125 - 19685180
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
19685125 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 19685180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 24443489 - 24443544
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
24443489 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 24443544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #189
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 338 - 381
Target Start/End: Original strand, 28107918 - 28107961
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
28107918 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 28107961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #190
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 28213446 - 28213489
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| |||||||||||||||||||||||||||||| ||| ||||    
28213446 ttttggtccctgcaaatatgcctcgttttggttttggtctctgg 28213489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #191
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 28213490 - 28213541
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
28213490 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 28213541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #192
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 28871711 - 28871754
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||| ||| |||||||||||||||||||    
28871711 ttttggtccctgcaaatatgtctcattttggttttagtccctgg 28871754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #193
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32108808 - 32108863
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||  ||||||| |||||| ||||||    
32108808 ggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg 32108863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #194
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 35609382 - 35609441
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
35609382 gtccctgtcgccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 35609441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #195
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 36973352 - 36973403
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||| ||| || |||||||| |||||||||||||||||    
36973352 tggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt 36973403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 1286974 - 1286932
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
1286974 ttttggtccctgcaaatatgcctcattttggttttggtccctg 1286932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 12145181 - 12145127
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    ||||||||| ||||| ||||||||||||||| ||||||||| |||| ||| ||||    
12145181 ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg 12145127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||| |||| |||| ||||||||||| ||||||||| ||||||||||    
20418013 taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc 20417963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  | ||||| ||||||||||||  |||||||||||||||||||||    
27916462 gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg 27916516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 29855614 - 29855668
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||  |||| |||| || ||||||||||| ||||||||||||||||||    
29855614 gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg 29855668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 273
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||| ||||||||||||||| ||||||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagtc 31602259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 31602515 - 31602465
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||||||||||| | | |||||||| ||||||||| |||||||    
31602515 ggctaaaatatagttttagttcatacaaatatgtctcgttttgattttagt 31602465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 387
Target Start/End: Original strand, 32888798 - 32888848
Alignment:
337 cccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||| || ||||||||||| || |||||||| ||||    
32888798 cccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt 32888848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||| ||||| ||||||||||||||| ||||||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||| ||||| |||||||||||||||  ||||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 10830897 - 10830844
Alignment:
222 ggctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| | |||| ||||||||||||||||||  |||||||||||||||    
10830897 ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc 10830844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 270
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||| |||||||| |||||||||||| || ||||||||||||    
18286431 taaaatatggttttagttcctgcaaatatgtcttgttttggtttta 18286476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||  |||| || |||||||||||| ||||||||||||||||||    
20691094 ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc 20691045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 38496420 - 38496476
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||||||||||||| || ||||||| ||  ||||||||||||||| ||||    
38496420 ggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtccttggt 38496476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||| ||||||| ||| ||||||||||||| ||||    
1287042 taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg 1286990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 358
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgca 358  Q
    |||||||||||| |||||| |||||||||||||||||    
26133311 aaaatagtccctaaccccatttttgtgatgatttgca 26133275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||| |||||||||||||||||| ||||||||||| |||||    
32888760 ttttggtccctgcaaatatgccttgttttggttttggtccc 32888800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 38554751 - 38554800
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||  |||||||||||||  ||||||||||||||||||    
38554751 ggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtc 38554800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 99; Significance: 9e-49; HSPs: 232)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45073641 - 45073463
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||                
45073641 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaaatttttgttttt 45073542  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45073541 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 45073463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 17999721 - 17999545
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |        |||||||||||||||||||||            |    
17999721 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttg 17999623  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
17999622 aaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 17999545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 7431950 - 7432131
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||           |||||||||||||||||||||             
7431950 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 7432049  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7432050 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 7432131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 44508719 - 44508898
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||        || |||||||||||||||||||               
44508719 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccctgcaaaaatttttgtttt 44508818  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||    
44508819 tgaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaattttgtagtttttgg 44508898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35015220 - 35015040
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||        ||   |||||||||||||||||||              
35015220 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgttt 35015121  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35015120 ttgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 35015040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 221 - 398
Target Start/End: Complemental strand, 1007230 - 1007051
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| |||||||||||| |||||||||||||||||| ||||||||| ||||          |||||||||||||||||||||              
1007230 tggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 1007131  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1007130 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 1007051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 44344789 - 44344612
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||          |||||||||||||||||||||            |    
44344789 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaaatttttgtttttg 44344690  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
44344689 aaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaattttatagtttttgg 44344612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 45021493 - 45021675
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttgg-ttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnn 316  Q
    |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |           ||||||||| |||||||||||            
45021493 tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccctgcaaaattttttgt 45021592  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45021593 ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 45021675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 37372904 - 37372726
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||           |||||||||||||||||||||                
37372904 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 37372805  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
37372804 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaattttgtagtttttgg 37372726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19783815 - 19783994
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||            ||||||||||||||||||||                
19783815 ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtccctgcaaatttttttgtttt 19783914  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19783915 tgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 19783994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 30352563 - 30352740
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||        ||   |||||| ||||||||||||            |    
30352563 taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaattttttgtttttg 30352662  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30352663 aaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 30352740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 39719352 - 39719533
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| |||||||||||| |||||||||||| |||||||||||||| |||             |||||||||||||||||||||             
39719352 tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaaaaagaaaattttgtttttggtccctgcaaaagattttgtt 39719451  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39719452 tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 39719533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 28911577 - 28911757
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||             |||||||||||||||||||||              
28911577 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 28911676  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||    
28911677 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacccattttgtagtttttgg 28911757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 48359076 - 48358898
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||| | ||          ||||||||| |||||||||||                
48359076 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaaaaaaaaattgtttttgatccctgcaaaattttttgttttt 48358977  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48358976 taaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 48358898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 19561153 - 19561327
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||| |             |||||||||||||||||||||                
19561153 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttca----aaaaaattttgtttttggtccctgcaaaattttttgttttt 19561248  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
19561249 gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 19561327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 46304385 - 46304203
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn 316  Q
    ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||              |||||||| ||||||||||||            
46304385 tggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaaaatttgttttttgtccctgcaaaattttttgt 46304286  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46304285 ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 46304203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5308686 - 5308508
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||            |||||||||||||||||||||               
5308686 ggctaaaatat-gttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 5308588  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
5308587 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 5308508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 21554753 - 21554575
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||            |||||||||||||||||||||               
21554753 ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 21554654  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
     ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||    
21554653 tgaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaattttgtagtttttg 21554575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 6108596 - 6108518
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6108596 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 6108518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 39832906 - 39833081
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||          ||||||||||||||| ||||             |    
39832906 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctacaaatttttttgtttttg 39833005  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||    
39833006 aaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttngtagttttt 39833081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1559705 - 1559527
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||  ||||||||||||           ||||||||||||| |||||||                
1559705 ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgttttt 1559606  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||    
1559605 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttataatttttgg 1559527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 12894301 - 12894223
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12894301 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 12894223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 21223508 - 21223586
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21223508 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 21223586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 31732350 - 31732272
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31732350 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 31732272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 488814 - 488892
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
488814 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 488892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 225 - 390
Target Start/End: Original strand, 30709328 - 30709494
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    ||||||||  ||||||||||| |||||||||||||||||||||||||||| ||           |||||||||||||||||||||            |||    
30709328 taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 30709427  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 390  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30709428 aatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgt 30709494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 44403250 - 44403073
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct-ggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| |||||||||| |||||||||| |||||||||||||||||||||            |||||||||||| ||||||||               
44403250 tggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctataaaaaaaaaattgtttttggtcactgcaaaa--aattgtttt 44403153  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
44403152 agaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaattttgtagtttttgg 44403073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 18022468 - 18022545
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
18022468 aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 18022545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 18311682 - 18311759
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
18311682 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaattttgtagtttttgg 18311759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 225 - 398
Target Start/End: Original strand, 14738603 - 14738777
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    ||||||||  |||||||||||||||||||||||| ||||||||||||||| ||||          ||||||||||||| |||||||            ||    
14738603 taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc-tggtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttttga 14738701  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
14738702 aaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtaatttttg 14738777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 19757748 - 19757929
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg----tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||     |        ||||||||||||| ||||||              
19757748 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttgttttgtttttggtccttgcaaattcttttgtt 19757847  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
19757848 tttgaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 19757929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 10358001 - 10358181
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||  | |||||||||||||||||||||||||||||||||||||||||              |||||||||||||||||||||             
10358001 ggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaagttttgtttttggtccctgcaaaattttttgtt 10358100  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
        ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||    
10358101 ttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttg 10358181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 13769773 - 13769950
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||          ||||||||||||| |||||||                
13769773 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgtttttggtccttgcaaaattttttgttttt 13769872  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| |||||| | ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
13769873 taaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacctattttgtagtttttgg 13769950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 221 - 386
Target Start/End: Complemental strand, 25547491 - 25547325
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||           ||||||||||||| |||||||               
25547491 tggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaattgtttttggtccttgcaaaattttttgtttt 25547392  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatt 386  Q
     |||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
25547391 tgaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaatt 25547325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 35210515 - 35210333
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-----gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnn 316  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||               |||||| |||||| |||||||            
35210515 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaataaaattgtttctggtccttgcaaaattttttgt 35210416  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
        ||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||    
35210415 ttttgaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaatcaattttgtagtttttgg 35210333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 31310577 - 31310500
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||    
31310577 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaatccattttgtagtttttgg 31310500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 20388274 - 20388453
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt--gtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||           |  |||||||||||||||||||               
20388274 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaaatctgtttttggtccctgcaaaattttttgtctt 20388373  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||| |||||||||| |||||||||||||||||||||||||| || || |||||||| ||||||||||||||||    
20388374 ttaaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaaccgattttgtagtttttgg 20388453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 321 - 384
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 384  Q
    |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
22871162 gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22871225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 1006834 - 1006892
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
1006834 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 1006892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 30352905 - 30352847
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
30352905 tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt 30352847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 6108334 - 6108391
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
6108334 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 6108391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 44509054 - 44508997
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
44509054 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 44508997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12894402 - 12894347
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
12894402 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 12894347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28911906 - 28911851
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28911906 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28911851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 23816933 - 23816856
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||||| ||||||||||||||| ||||||||||||| || ||| |||| ||||||||||||||||    
23816933 aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgattttgtagtttttgg 23816856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 10358369 - 10358313
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
10358369 tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 10358313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 16853590 - 16853534
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
16853590 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 16853534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 335 - 399
Target Start/End: Original strand, 19465733 - 19465797
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
19465733 accccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 19465797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 39833237 - 39833181
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
39833237 tggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 39833181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1559343 - 1559398
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||    
1559343 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg 1559398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1614904 - 1614849
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
1614904 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1614849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3975549 - 3975604
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
3975549 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3975604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 6509208 - 6509263
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||    
6509208 ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg 6509263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6509470 - 6509415
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
6509470 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 6509415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8144658 - 8144603
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
8144658 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8144603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 8555799 - 8555744
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||    
8555799 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg 8555744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9659689 - 9659634
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
9659689 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 9659634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||    
17999465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg 17999520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
19561450 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 19561395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 23399612 - 23399667
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
23399612 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23399667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23676452 - 23676397
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
23676452 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23676397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25988749 - 25988694
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
25988749 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 26878071 - 26878016
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
26878071 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 26878016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29198662 - 29198607
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29198662 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29198607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45228918 - 45228863
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
45228918 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 45228863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 46648516 - 46648590
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||| |||||||| |||||||||||||||| |||||||||||| || |||||||| ||||||||||||||    
46648516 aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacccattttgtagttttt 46648590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48192488 - 48192433
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
48192488 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||    
6079810 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 6079864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 21223748 - 21223694
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||    
21223748 ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct 21223694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 14739004 - 14738947
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||    
14739004 ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt 14738947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    
32189388 ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg 32189335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 1974008 - 1974064
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||  |||||||||||||||||||||    
1974008 tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 1974064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 1974207 - 1974147
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||| ||||||||||||||||||||| || |||||||||||||||||||| ||||||||||    
1974207 cactattgtgatgatttgcatacgtgacaaattataactgaaccaattttttagtttttgg 1974147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3975838 - 3975786
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
3975838 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc 3975786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 18022704 - 18022652
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  ||||||||||||||||||||||||||||||||||||||||    
18022704 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc 18022652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 27037592 - 27037648
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
27037592 tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 27037648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 31732100 - 31732156
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||    
31732100 tggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg 31732156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
48192260 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 1614559 - 1614614
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
1614559 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1614614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5233808 - 5233863
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
5233808 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 5233863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 5354768 - 5354823
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||    
5354768 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg 5354823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 8144295 - 8144350
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
8144295 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 8144350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 13770081 - 13770026
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||    
13770081 ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg 13770026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23399976 - 23399921
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
23399976 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23399921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 23816670 - 23816721
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||    
23816670 ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc 23816721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25092160 - 25092215
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
25092160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25092215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 25092548 - 25092493
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
25092548 ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg 25092493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25988385 - 25988440
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
25988385 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25988440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 27458399 - 27458454
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
27458399 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 27458454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||    
35104078 ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg 35104133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35104295 - 35104240
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||    
35104295 ggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35104240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35665877 - 35665932
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||    
35665877 ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg 35665932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35838337 - 35838282
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35838337 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35838282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 226 - 277
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 37372492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39719642 - 39719587
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||    
39719642 ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg 39719587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 41054236 - 41054181
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
41054236 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 41054181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44402960 - 44403015
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||    
44402960 ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg 44403015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45073314 - 45073369
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||    
45073314 ggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg 45073369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 397
Target Start/End: Original strand, 45671314 - 45671389
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||| ||||||||| || ||||||||||||||||||||||| ||||| || |||||||  ||||||||||||||    
45671314 aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaactcattttgtagttttt 45671389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 272
Target Start/End: Complemental strand, 45021856 - 45021806
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||    
45021856 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 45021806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 6589020 - 6589073
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||| ||||    
6589020 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc 6589073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||    
17854151 ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg 17854204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 21554392 - 21554445
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||||  |||||||||||| |||||||||||||||||||||||||||    
21554392 tggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc 21554445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||||||||||||||||||||| ||||| || |||||||    
35665984 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac 35666037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||||||||| || |||||| ||||||||||||    
43058752 ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg 43058805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 5308322 - 5308378
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||| |||||||||| |||||||| |||||||||||||    
5308322 tggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg 5308378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
16941049 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16940997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 18927092 - 18927040
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||||||||||||||||||| ||| |||| |||||||||    
18927092 tggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc 18927040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
23676135 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23676187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 30223795 - 30223743
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||| ||||||||||||||||||||||||||||||    
30223795 ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc 30223743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 35837924 - 35837976
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
35837924 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 35837976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46304086 - 46304138
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  ||||||| ||||||||||||||||||||||||||||||||    
46304086 ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc 46304138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 46648715 - 46648667
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||||||| |||||||||||||||||||||||||||    
46648715 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46759658 - 46759710
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||||||||||||    
46759658 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc 46759710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 48852444 - 48852496
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||||||||||||||||||||| ||||||||||    
48852444 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc 48852496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 1271587 - 1271544
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
1271587 gttttggtccctgcaaatatgcctcgttttggttttagtccctg 1271544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 2945845 - 2945790
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| |||||| |||||||||||||||||||||||||||||||    
2945845 ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg 2945790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3807864 - 3807919
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| || |||||||||||| ||||||||||||||||| ||||    
3807864 ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg 3807919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 5234204 - 5234149
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||| ||||||||||||||||||||||    
5234204 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 5234149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 9659464 - 9659523
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
9659464 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9659523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| ||||| |||||||||||||||||||||||||||||| ||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct 11766971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 11767275 - 11767220
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| || ||||||||||||||||||    
11767275 ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg 11767220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12932783 - 12932728
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||    
12932783 ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg 12932728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 16940762 - 16940817
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||| |||| ||||| |||||||||||||||||||| |||||||||||||||||    
16940762 ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg 16940817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  ||||||||||||||||||||| |||||||||||||||||    
21223405 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc 21223456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||| |||||| ||||||||||||||||||||||||||||||||    
25547256 taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 25547303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28262713 - 28262768
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||| ||||||    
28262713 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg 28262768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29198303 - 29198358
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||  ||||||||||||||||||||||    
29198303 ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 29198358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30223461 - 30223516
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||| ||||||||| ||||||||||||||||||||||    
30223461 ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 30223516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 30709644 - 30709593
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  |||||||||||||||||||| ||||||||||||||||||    
30709644 ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc 30709593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 39438741 - 39438792
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||| ||||||||||||||||||||||||||    
39438741 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc 39438792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 39439029 - 39438974
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||| | ||||||||||||||||||||||    
39439029 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 39438974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41053842 - 41053897
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||| ||||||||||||    
41053842 ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg 41053897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 322 - 396
Target Start/End: Complemental strand, 41365112 - 41365040
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt 396  Q
    |||||||||||  |||| | |||||||||||||||||||| |||||||| || |||||||| |||||||||||||    
41365112 aaaatagtccc--acccaatttttgtgatgatttgcatacatggcacatgatgactgaacccattttgtagtttt 41365040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| |||||||| |||||||||||| |||||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc 43300664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 44568326 - 44568381
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||  ||||||||||||||||||||||    
44568326 ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg 44568381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44568690 - 44568635
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
44568690 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 44568635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||| ||||||||||||||||||||||    
46759942 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg 46759887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 46828944 - 46828999
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| || |||||||||||||||||||    
46828944 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg 46828999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 24954049 - 24953979
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||||||  ||||| ||||||| |||||||||||||| ||||||||| || |||||||| |||||||||    
24954049 aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacctattttgtag 24953979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 268
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttt 268  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||    
31310679 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt 31310633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| ||||| |||||||||||||||||| ||||||||||||||||    
6589271 taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc 6589222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| ||||| |||||||||||||||| |||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc 6847068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||| ||||||||||| ||||||||| |||||||||||||||||    
18022368 gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt 18022417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 271
Target Start/End: Complemental strand, 31732451 - 31732402
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag 271  Q
    ||||||||||| |||||||||| |||||||||||||||||||| ||||||    
31732451 ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag 31732402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 32189075 - 32189124
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||  ||||||||||||||||||||| ||||||||||||||    
32189075 tggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 387
Target Start/End: Original strand, 35104125 - 35104186
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||| ||  ||||||| ||||    
35104125 tagtccctgactccacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt 35104186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||| |||||||| || |||||||||||||||||||||||||||    
41365213 gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt 41365164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 43300730 - 43300787
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| |||||||||||||||||||||| || |||||||| ||| ||||||||||||    
43300730 ttttgtaatgatttgcatacgtggcacatgatgactgaacctattgtgtagtttttgg 43300787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||| ||| ||||| ||||||||||||||||||||||||||||||||||    
5355114 taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc 5355066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 237 - 277
Target Start/End: Original strand, 12894056 - 12894096
Alignment:
237 ttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||||||||||||||||||| ||||||    
12894056 ttagtccctgcaaatatgcctcgttttggttttaatccctg 12894096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 14543710 - 14543762
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||    
14543710 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc 14543762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
237 ttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||||||| ||||||||||||||||||    
19758044 ttagtccctgcaaatatgcctcattttggttttagtccctg 19758004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 20388676 - 20388620
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||| ||| ||||||||||||||||| ||||||| ||||    
20388676 tggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg 20388620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||||||||||||||||||| ||||||||| ||||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc 31503732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 399
Target Start/End: Complemental strand, 32189280 - 32189216
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||| |||||||||||||||||||  |||||||| || | |||||| ||||||||||||||||    
32189280 accccatttttgtgatgatttgcatatatggcacatgatgattgaacccattttgtagtttttgg 32189216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 322 - 370
Target Start/End: Complemental strand, 37952950 - 37952902
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    |||||||||| |||||||||||||||||| |||||||||||| ||||||    
37952950 aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacat 37952902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||| |||||| |||||    
38186369 taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg 38186421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||  |||||||||||||||||||||||| ||||||||||||    
44841359 taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg 44841411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 46829313 - 46829257
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||  |||||||||||||| ||| ||||||||||||||||||    
46829313 tggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg 46829257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 489072 - 489017
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||||||| ||||||||||| ||||||||| ||||||||||||    
489072 ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg 489017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 5355009 - 5354950
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
5355009 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 5354950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 9659355 - 9659410
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||| ||||||||||||    
9659355 ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 9659410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||| ||||||||| || ||||||||||||||||||||||||    
18311581 gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta 18311628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19465980 - 19465926
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||| ||||||||||||| ||||||| ||||||||||||||    
19465980 ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg 19465926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 24717533 - 24717478
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| |||||| | |||||| |||||||||||||||||||||    
24717533 tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct 24717478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 26877678 - 26877733
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  || ||||||||||| ||||||||||||||||||||||    
26877678 ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg 26877733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 31310365 - 31310416
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  |||||||||||||||||||  ||||||||||||||||||    
31310365 ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc 31310416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| ||||| ||||||| ||||||| |||||||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct 34877828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35470280 - 35470225
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| | |||||  |||||||||||||||||| ||||||||||||||||||    
35470280 ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg 35470225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 35838033 - 35838092
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||| ||| ||||    
35838033 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactggacccattt 35838092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 39520398 - 39520453
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| | |||||||| ||||||||||||||||||||||    
39520398 ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg 39520453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 39520507 - 39520566
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
39520507 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 39520566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 41364884 - 41364939
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| || || |||||||| ||||||||||||||||||||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg 41364939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 44958506 - 44958451
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| |||||| |||||||| ||||||||||||||||||||||    
44958506 ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg 44958451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45228615 - 45228670
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| | ||| |||||||||||||||||| |||||||||||||    
45228615 ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg 45228670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46759864 - 46759805
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
46759864 gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 46759805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||| ||||||||||||||||||||||| |||||||||||    
2945736 gtccctggccccacttttgtgatgatttgcacacgtggcacat 2945694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 7432249 - 7432195
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||| |||||| | |||||||||||||||||||||| |||||||| |||||    
7432249 taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggt 7432195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 323 - 365
Target Start/End: Complemental strand, 17854356 - 17854314
Alignment:
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtgg 365  Q
    |||||||||||||| ||| ||||||||||||||||||||||||    
17854356 aaatagtccctgactccatttttgtgatgatttgcatacgtgg 17854314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||||||| ||||||| ||||||| ||||||||| |||||||    
19005598 ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt 19005648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||||| |||||||| || |||||||||||||||||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg 37527367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| ||||||||||||||||||    
41054163 ttttggtccctgcaaatatgcctcattttggttttagtccctg 41054121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #184
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 3975730 - 3975677
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||| |||||||||| |||||||||| ||||||||||| || |||||||    
3975730 gtccctgactccacttttgtaatgatttgcacacgtggcacatgatgactgaac 3975677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #185
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 6911248 - 6911199
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||||| ||||| || ||||||||||| ||||||||||||||||    
6911248 tggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta 6911199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 11767036 - 11767085
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
11767036 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 11767085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #187
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 16940871 - 16940924
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||    
16940871 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaac 16940924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 30223580 - 30223629
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
30223580 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 30223629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 388
Target Start/End: Original strand, 34877885 - 34877942
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
    |||||||||||||||||||||||||||| ||| ||||||| || | |||||| |||||    
34877885 cctgaccccacttttgtgatgatttgcacacgcggcacatgatgattgaacccatttt 34877942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #190
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||| ||||||| ||  ||||||||||||||||||    
37952671 ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg 37952724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #191
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 38186642 - 38186589
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||||||||||||||||| ||||| ||||| || |||||||| |||||||||    
38186642 cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattttgtag 38186589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 8555607 - 8555655
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||||||||||  ||||||||||| || ||||||||||||    
8555607 ggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta 8555655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||||||||||||||||||| ||||||||  ||||||||    
18891562 taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc 18891514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 24953832 - 24953872
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||||||||||||| | ||||||||||||||||    
24953832 gttttagtccctgcaaatatgcattgttttggttttagtcc 24953872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 34878125 - 34878077
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| |||||  |||||||||||||| |||||||||||||||    
34878125 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta 34878077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 35469879 - 35469931
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||| |||||  ||||||||||||||  |||||||||||||||||    
35469879 tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc 35469931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||||||||||| ||||||| || |||||||||||||||    
37953048 taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc 37953000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 38186761 - 38186709
Alignment:
222 ggctaaaatat-agttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| | |||| ||||||||||||||| ||||||||||||||||||    
38186761 ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc 38186709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||| |||||||||| ||||||||| ||||||||||||    
39520727 taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg 39520675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 387
Target Start/End: Original strand, 44841471 - 44841523
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||| | ||||||||||| || |||||||| ||||    
44841471 accccacttttgtgatgatttggacacgtggcacatgatgactgaacccattt 44841523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #201
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 367
Target Start/End: Original strand, 6892003 - 6892042
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggca 367  Q
    ||||||||||||||||||||||||||||||| | ||||||    
6892003 gtccctgaccccacttttgtgatgatttgcacaggtggca 6892042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #202
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 6892260 - 6892205
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||| ||| || ||||||| |||||||||||    
6892260 ggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg 6892205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #203
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
226 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||| ||||| ||||||||||||||  ||||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc 6954909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #204
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22539930 - 22539985
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||| |||||||||||| ||||||||||||| ||||    
22539930 ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg 22539985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #205
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 23817034 - 23816979
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| ||| ||||||| ||||||||||| ||||| ||||    
23817034 ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg 23816979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #206
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 27458472 - 27458515
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
27458472 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 27458515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #207
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 27458508 - 27458567
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
27458508 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 27458567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #208
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| || |||| ||||||| ||||||| ||||||||||||||    
28528905 ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg 28528960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #209
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35210182 - 35210237
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  ||||  |||| ||||||||| ||||||||||||||||||||||    
35210182 ggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg 35210237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #210
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 35470159 - 35470112
Alignment:
340 acttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||| ||||||||||| || |||||||| ||||    
35470159 acttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35470112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #211
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 35470207 - 35470164
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
35470207 tttttgtccctgcaaatatgcctcattttggttttggtccctgg 35470164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #212
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 38486790 - 38486739
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||  |||||| ||||||||| ||||||||||||||||    
38486790 ggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc 38486739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #213
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 41054067 - 41054008
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| | ||||||||| || |||||||| ||||    
41054067 gtccctggctccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 41054008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #214
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 41054103 - 41054060
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
41054103 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 41054060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #215
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 45228693 - 45228752
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||| ||||||||||||||||| ||||||||||| || |||||||| ||||    
45228693 gtccctggctccatttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 45228752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #216
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 276
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| |||||||||  |||||||||| |||||||| ||||||||||||    
45671545 taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct 45671494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #217
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 46829201 - 46829142
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| || || ||||| || | |||||||||||    
46829201 gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaattt 46829142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #218
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48854070 - 48854015
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  ||||  ||||||||||||||  |||||||||||||||||||||    
48854070 ggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg 48854015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #219
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 273
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||| ||||||||||||||| ||||||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagtc 3808068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
3975766 ttttggtccctgcaaatatgcctcattttggttttggtccctg 3975724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #221
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 370
Target Start/End: Complemental strand, 6847007 - 6846969
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    ||||||||||||||||||||||||||  |||||||||||    
6847007 ctgaccccacttttgtgatgatttgcgcacgtggcacat 6846969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #222
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
9659428 ttttggtccctgcaaatatgcctcattttggttttggtccctg 9659470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #223
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 243 - 277
Target Start/End: Complemental strand, 27458698 - 27458664
Alignment:
243 cctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||| |||||||||||||    
27458698 cctgcaaatatgcctcgttttagttttagtccctg 27458664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #224
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 381
Target Start/End: Complemental strand, 38486673 - 38486631
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||||||||||||||||||| ||||||||||| || |||||||    
38486673 cacttttgtgatgatttgcacacgtggcacatgatgactgaac 38486631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 387
Target Start/End: Complemental strand, 3808072 - 3808011
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||| |||||| |||||||||||||||||||| ||||| ||||| || || ||||| ||||    
3808072 tagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatgaccgaacccattt 3808011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 6589080 - 6589129
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
6589080 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 6589129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 18926889 - 18926942
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||||| | | |||||||| ||||||||||||| ||||||||    
18926889 ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg 18926942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||| ||||||||||||||| |||||||||||||| |||||    
19005865 ttttggtccctgcaaatatgtctcgttttggttttggtccc 19005825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 337 - 381
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
337 cccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||    
28262960 cccacttttgtgatgatttgcacacgtgacacataatgactgaac 28262916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #230
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 269
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    |||||||| ||||| ||| ||||||||||| ||||||||||||||    
28529206 taaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #231
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| | ||||| ||||||| ||| ||||||||||||||||||    
31503423 taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg 31503475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #232
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 44344457 - 44344505
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| |||||||| || ||||||||| ||||||| |||||||    
44344457 ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta 44344505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 9e-49; HSPs: 294)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 3152111 - 3151934
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
3152111 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt 3152012  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
     |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3152011 tgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 3151934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 39437109 - 39436929
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
39437109 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 39437010  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
39437009 ttgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 39436929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 10976977 - 10977157
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||| ||||||||||||||              
10976977 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccctgcaaaattttttgttt 10977076  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
10977077 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaattttgtagtttttgg 10977157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 28427608 - 28427429
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||               
28427608 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 28427509  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
28427508 tgaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaattttgtagtttttgg 28427429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 37506867 - 37507046
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||                 
37506867 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaattttttttgtttt 37506966  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37506967 tgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 37507046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 8510213 - 8510394
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||           |||||||||||||||||||||             
8510213 tggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgtt 8510312  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8510313 tttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 8510394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 22155929 - 22156109
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||           |||||||||||||||||||||              
22155929 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 22156028  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22156029 ttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 22156109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 39288898 - 39288720
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||         ||| |||||||||||||||||                
39288898 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattgattttggtccctgcaaaattttttgttttt 39288799  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
39288798 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 39288720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 275444 - 275621
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||          |||||||||||||||||||||            |    
275444 ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgcaaaaaaaaattgtttttggtccctgcaaaattttttgtttttg 275543  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
275544 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 275621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51834942 - 51834763
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||          |||||||||||||||||||||               
51834942 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaactttttgtttt 51834843  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||    
51834842 tgaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaattttgtagtttttgg 51834763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 21159817 - 21159637
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||             |||||||||||||||||||||              
21159817 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaattttttgttt 21159718  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21159717 ttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 21159637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 34238598 - 34238775
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||          |||||||||||||||||||||               
34238598 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttt 34238697  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
     |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
34238698 tgaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 34238775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 222 - 398
Target Start/End: Original strand, 26799888 - 26800067
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
26799888 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 26799987  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
26799988 ttgaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttttagtttttg 26800067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 20757403 - 20757578
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    ||||||||  ||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||            |||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 20757502  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
20757503 aatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 20757578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 40169655 - 40169474
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||           ||||||||||||||| |||||             
40169655 tggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaattttttgtt 40169556  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
40169555 tttgaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaatcaattttgtagtttttgg 40169474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 45320979 - 45320801
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||          || ||||||| |||||||||||                
45320979 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatttgtttttgatccctgcaaaattttttgttttt 45320880  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
45320879 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 45320801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 14633889 - 14633708
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||| ||| ||||||||||||||||||||| || |||||||||||||||||||||            |||||||||||||||||||||             
14633889 ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaattttttgtt 14633790  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
14633789 tttgaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 14633708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 13584105 - 13584183
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13584105 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 13584183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 19656802 - 19656724
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19656802 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 19656724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 222 - 395
Target Start/End: Complemental strand, 20612898 - 20612724
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||        || ||||||||||| ||||||                 
20612898 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttgtttttggtccttgcaaatttttttgttttt 20612799  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttt 395  Q
    | |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
20612798 ggaaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacaaattttgtagttt 20612724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 225 - 399
Target Start/End: Complemental strand, 20907454 - 20907278
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnnnga 322  Q
    |||||||| |||||| |||||||||||||||||| |||||||||||||| |||            |||||||||||||||||||||            ||    
20907454 taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttga 20907355  T
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
20907354 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 20907278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 29955300 - 29955478
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||             ||||||||||||||||||||                 
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 29955399  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||    
29955400 gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaattttgtagtttttgg 29955478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 224 - 399
Target Start/End: Original strand, 30004454 - 30004632
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||             ||||||||||||||||||||                 
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaatttttttgttttt 30004553  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||    
30004554 gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaattttgtagtttttgg 30004632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 397
Target Start/End: Original strand, 3830134 - 3830308
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |        ||||||||||||| |||||||            |    
3830134 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg-taaaaaaaattgtttttggtccttgcaaaattttttgtttttg 3830232  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||  ||||||||||||||    
3830233 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaactcattttgtagttttt 3830308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 225 - 399
Target Start/End: Original strand, 45161116 - 45161291
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaa 323  Q
    |||||||| |||| |||||||||||||||| |||||||||||||||||| |||           |||||||||||||||||||||            |||    
45161116 taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaa 45161215  T
324 aatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
45161216 aatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 45161291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 4950266 - 4950188
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4950266 gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 4950188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 30130158 - 30130336
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||           |||||||||||||||||||||                
30130158 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 30130257  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
30130258 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaattttgtagtttttgg 30130336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 39072112 - 39072034
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
39072112 gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 39072034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 247 - 399
Target Start/End: Complemental strand, 10778706 - 10778553
Alignment:
247 caaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtccctgaccccactttt 345  Q
    |||||||||||||||||||||||||||||||||         ||||| |||||||||||||||            |||||||||||||||||| ||||||    
10778706 caaatatgcctcgttttggttttagtccctggtaaaaaaaaattgttattggtccctgcaaaattttttgtttttgaaaatagtccctgaccctactttt 10778607  T
346 gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10778606 gtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 10778553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 4513620 - 4513442
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||           |||||||||||||||||||||                
4513620 ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattgtttttggtccctgcaaaattttttgttttt 4513521  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
4513520 taaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgattttgtagtttttgg 4513442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 18175791 - 18175966
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||| ||||||  ||||||| ||||||          |||||||||||||||||||||                 
18175791 ggctaaaatatggttttagtccctgcaaatatgtctcgtt--ggttttaatccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttta 18175888  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18175889 aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 18175966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 25710871 - 25710693
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||  |||||||              
25710871 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtc--tgcaaaattttttattt 25710774  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||| ||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||    
25710773 ttgaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttgtagtttttgg 25710693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 31869956 - 31869778
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||           |||||||||||||||||||||                
31869956 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaattgtttttggtccctgcaaaactttttgttttt 31869857  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| |||| |||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||    
31869856 gaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttatagtttttgg 31869778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 221 - 389
Target Start/End: Original strand, 29445953 - 29446124
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||             
29445953 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaattttttgtt 29446052  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttg 389  Q
        |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
29446053 ttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttg 29446124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 222 - 387
Target Start/End: Complemental strand, 5345689 - 5345522
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||            ||||||||| |||||||||||               
5345689 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaatttgtttttgatccctgcaaaattttttatttt 5345590  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
      |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5345589 ttaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 5345522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 221 - 398
Target Start/End: Original strand, 16123138 - 16123319
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnn 316  Q
    |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||              ||||||||| |||||| ||||            
16123138 tggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtacaaaaaaaaaaattgtttttgatccctgtaaaattttttgt 16123237  T
317 nnnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
        |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||    
16123238 ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtaatttttg 16123319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 9863404 - 9863224
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn--ttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||            | ||||||||||| |||||||               
9863404 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatagtttttggtccttgcaaaattttttgtttt 9863305  T
320 ngaaaatagtccctgaccccactttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||||||||||||| |||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
9863304 tgaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 9863224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 321 - 397
Target Start/End: Complemental strand, 12673904 - 12673828
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||    
12673904 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatagttttt 12673828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 7518346 - 7518268
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||    
7518346 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaattttgtagtttttgg 7518268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 46186771 - 46186591
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||             ||||||||||||| |||||||              
46186771 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaattttttgttt 46186672  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||| ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||    
46186671 ttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg 46186591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 333 - 399
Target Start/End: Complemental strand, 49670725 - 49670659
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
49670725 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttgtagtttttgg 49670659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 51500685 - 51500507
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||                
51500685 ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 51500586  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     ||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||| ||| ||||||||| ||||||    
51500585 taaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactggacccattttgtaggttttgg 51500507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 4814898 - 4814722
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||| |||||||||| |||||||||||||||||||||           |||||||||||||||||||||                 
4814898 ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccctataaaaaaaaattgtttttggtccctgcaaaattttttgtttttt 4814800  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| || ||||||||||||||||||||||||||||| || |||| ||| ||||||||||||||||    
4814799 aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtagtttttgg 4814722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 383
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
47901901 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca 47901963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 50261839 - 50261762
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| ||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||    
50261839 gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaattttgtagtttttgg 50261762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 221 - 399
Target Start/End: Original strand, 53701360 - 53701538
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| |||||| || ||||||||||||||  |||| |||||||||||||          |||||||||||||||||||||                
53701360 tggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgttttt 53701459  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
     |||||| || || |||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||    
53701460 taaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaattttgtagtttttgg 53701538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 15016645 - 15016568
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||    
15016645 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccattttgtagtttttgg 15016568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 51759819 - 51759999
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||| |||| |||||||||||| ||||||||||||||||||||||             |||||||||||||||||||||              
51759819 ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 51759918  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||| ||| ||||||||| ||||||    
51759919 tttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactggacccattttgtaggttttgg 51759999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 51834608 - 51834665
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
51834608 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 51834665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 223 - 279
Target Start/End: Complemental strand, 22156292 - 22156236
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
22156292 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt 22156236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 330 - 398
Target Start/End: Complemental strand, 30426175 - 30426107
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    ||||||||||| ||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||    
30426175 ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaattttgtagtttttg 30426107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4513263 - 4513318
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
4513263 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 4513318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 4950037 - 4950092
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
4950037 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 4950092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12673644 - 12673699
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
12673644 ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg 12673699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 37507222 - 37507167
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
37507222 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37507167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 3151750 - 3151804
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
3151750 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct 3151804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 45521650 - 45521728
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| || | |||| |||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||    
45521650 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagttttgtagtttttgg 45521728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 13584367 - 13584310
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
13584367 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt 13584310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Complemental strand, 15286402 - 15286325
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| |||| |||| ||||||||||||||||||||||||||||| || ||| |||| ||||||||||||||||    
15286402 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgattttgtagtttttgg 15286325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 28942905 - 28942848
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||    
28942905 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt 28942848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 399
Target Start/End: Original strand, 30552246 - 30552323
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||| ||||||| | |||| |||||||||||||||||||||||| || |||||||| ||||||||||||||||    
30552246 aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 30552323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 39436718 - 39436775
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
39436718 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 39436775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg 45006194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 50196354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3830516 - 3830464
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||    
3830516 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc 3830464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15016387 - 15016443
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    
15016387 tggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 15016443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 22008891 - 22008835
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
22008891 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22008835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 322 - 398
Target Start/End: Original strand, 30268585 - 30268661
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||| |||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |||||||||    
30268585 aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttatagtttttg 30268661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 49323781 - 49323837
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
49323781 tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 49323837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 323 - 399
Target Start/End: Original strand, 50196401 - 50196477
Alignment:
323 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||| || |||||||  ||| ||||||||||||    
50196401 aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacacattctgtagtttttgg 50196477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 7957118 - 7957059
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||    
7957118 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 7957059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 14633547 - 14633602
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggt 14633602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22008526 - 22008581
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
22008526 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 22008581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 22016044 - 22016099
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
22016044 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 22016099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25615975 - 25616030
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
25615975 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25616030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28552383 - 28552328
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
28552383 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28552328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30268505 - 30268560
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
30268505 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 30268560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 31480136 - 31480191
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
31480136 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 31480191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 339 - 398
Target Start/End: Original strand, 40979479 - 40979538
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
    |||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||    
40979479 cacttttgtgatgatttgcatacgtgtcacattataactgaactaattttgtaatttttg 40979538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 51550082 - 51550137
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
51550082 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 51550137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
53701663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 53701608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 54608518 - 54608573
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
54608518 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 54608573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 369
Target Start/End: Original strand, 28942525 - 28942674
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt--nnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnn 319  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||   ||||          |||||||||||||||||||||               
28942525 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccctgcaaaattttatgtttt 28942624  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 369  Q
      ||||||||| |||| |||||||||||||||||||||||||||||||||    
28942625 ttaaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca 28942674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||    
43440785 ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc 43440735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 9262155 - 9262102
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||    
9262155 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 9262102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 10977341 - 10977284
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||    
10977341 ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt 10977284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 20611020 - 20611077
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||    
20611020 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggt 20611077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 28427245 - 28427302
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||    
28427245 ggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt 28427302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 39288573 - 39288630
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||    
39288573 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggt 39288630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc 40370536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 43440614 - 43440671
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
43440614 ttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 43440671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 223 - 279
Target Start/End: Complemental strand, 3361817 - 3361761
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||    
3361817 gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt 3361761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 4034716 - 4034772
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
4034716 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 4034772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
8940522 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8940470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 9261788 - 9261844
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
9261788 tggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 9261844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 15979337 - 15979393
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
15979337 tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 15979393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 26089729 - 26089785
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
26089729 tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 26089785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 26090079 - 26090023
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
26090079 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 26090023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 31480501 - 31480445
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||    
31480501 tggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg 31480445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 44802281 - 44802337
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||    
44802281 tggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg 44802337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 392
Target Start/End: Complemental strand, 45313864 - 45313690
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt---gtttttggtccctgcaaaannnnnnnnn 317  Q
    |||||||||||| ||||| |||||||||||||||| |||||||| ||||||||||||          ||   |||||||||||||||||||             
45313864 tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattttgat 45313765  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
       | |||||||||||| ||||||||||||||||||||| ||| ||||| ||| || |||||||| |||||||||    
45313764 tttggaaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccattttgtag 45313690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 46751271 - 46751323
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||||||||    
46751271 ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc 46751323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 47902146 - 47902090
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||||||||| |||||||||| | |||||||||||||||||||    
47902146 tggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg 47902090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 474044 - 474099
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
474044 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 474099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 1721452 - 1721397
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
1721452 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 1721397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 7588318 - 7588369
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||||||||| |||||||||||||||||| |||||||||||||||    
7588318 ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc 7588369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 12740907 - 12740962
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
12740907 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12740962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 12741271 - 12741216
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
12741271 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12741216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 19844581 - 19844526
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||    
19844581 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 19844526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 28552021 - 28552076
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||    
28552021 ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg 28552076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29678024 - 29678079
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| |||  |||||||||||||||||||||||||||||||||    
29678024 ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg 29678079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 29955666 - 29955611
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||    
29955666 ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 29955611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30004821 - 30004766
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||    
30004821 ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg 30004766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30106220 - 30106165
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||    
30106220 ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg 30106165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||    
30552478 ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg 30552423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 32119220 - 32119275
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||    
32119220 ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg 32119275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 32119584 - 32119529
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||  |||| ||||||||||||||||||||||||||||||||||||||    
32119584 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 32119529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 40277931 - 40277990
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||    
40277931 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40277990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 43441603 - 43441548
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||||||||    
43441603 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 43441548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 45002021 - 45002076
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||    
45002021 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 45002076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 45002385 - 45002330
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||    
45002385 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 45002330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47336228 - 47336283
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||    
47336228 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 47336283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 47336581 - 47336526
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
47336581 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47336526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 48924240 - 48924185
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||    
48924240 ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg 48924185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 279
Target Start/End: Complemental strand, 49670804 - 49670745
Alignment:
221 tggctaaaatatagttttagtccc-tgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||    
49670804 tggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt 49670745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 50196657 - 50196602
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||    
50196657 ggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg 50196602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 51550446 - 51550391
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
51550446 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 51550391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 54608863 - 54608808
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
54608863 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 54608808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 9603629 - 9603683
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||  ||||||||||||||||||||||||||||||||||||    
9603629 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct 9603683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| || |||||||||||||||||||||||||||||||||||    
11463233 gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg 11463287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 14772211 - 14772264
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||||| |||||||||||||||| |||||||||||||||||||    
14772211 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc 14772264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 34238915 - 34238858
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||| |||||||||| |||||||||||||||||| ||||    
34238915 ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt 34238858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 40169344 - 40169401
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||| |||||||||||||| ||||||||| ||||||||||||||    
40169344 ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt 40169401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3387604 - 3387552
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||| |||||||||||||||||||||||||||||||    
3387604 ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc 3387552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 4035054 - 4034998
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||    
4035054 tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg 4034998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||| ||||||||||||||| || |||||||||||||||||||    
4322186 taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg 4322134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 4814540 - 4814588
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||||    
4814540 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 4814588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 7518090 - 7518142
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| || ||||||||||||||||||||||||||| ||||||||||    
7518090 ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc 7518142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 7957227 - 7957171
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| |||||||||||||||| |||||||||||||||||||||    
7957227 tggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg 7957171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 19656541 - 19656593
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| |||||||||| |||||||||||||||||||| |||||||||    
19656541 ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc 19656593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 20644504 - 20644560
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||    
20644504 tggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg 20644560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 21159453 - 21159505
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||    
21159453 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 21159505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 29446206 - 29446154
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| || ||||||||||||||||    
29446206 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc 29446154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 29525105 - 29525157
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| |||||||| ||||||||||    
29525105 ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc 29525157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
35569133 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35569081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 39072214 - 39072158
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| |||||||| |||||||||||||||||||||| ||||| ||||||    
39072214 tggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg 39072158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 43441269 - 43441325
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| ||||||||||||||| ||||||||||||||||| ||||    
43441269 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 43441325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 47005519 - 47005467
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||||||||||| ||||||||||||||||||||    
47005519 ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc 47005467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 223 - 271
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttag 271  Q
    |||||||||| ||| ||||||||||||||||||||||||||||||||||    
51760117 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag 51760069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 52342583 - 52342531
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||| |||||||||||||||||||||||||||||||    
52342583 ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc 52342531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 474408 - 474353
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||| ||||    
474408 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 474353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 4034826 - 4034885
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
4034826 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 4034885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 228 - 279
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
228 aatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||| |||||||||||||||||||||  |||||||||||||||||||||||    
8510523 aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt 8510472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 9262045 - 9261986
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
9262045 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 9261986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 9597095 - 9597040
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||||||||||||| |||||||||||||||||||||    
9597095 ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg 9597040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||| |||||||||||||||| ||||||||||||||||||||||||||    
9863050 taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct 9863100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 15286156 - 15286207
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| |||||| ||||||||||||||| |||||||||||||||||    
15286156 ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc 15286207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15979701 - 15979646
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| |||||||| ||||||||||||||||||||||    
15979701 ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg 15979646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 21553889 - 21553944
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||    
21553889 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg 21553944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||| ||||| ||||||||||||||||||||||||| |||||||||    
25610129 gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc 25610078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25710510 - 25710565
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||| ||||||||||||||||||||| ||||||||| ||||||||||||    
25710510 ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 25710565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 28452376 - 28452321
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||| ||||||||| |||||||||||||||||||||    
28452376 ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg 28452321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 29490743 - 29490692
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||    
29490743 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc 29490692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35565508 - 35565563
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||||||||||||| |||||||||||||||||||||||    
35565508 ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg 35565563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40545564 - 40545619
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||| |||||||||||||    
40545564 ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg 40545619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 40979710 - 40979655
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||| ||||||    
40979710 ggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg 40979655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||  |||||||||||||||||||||||||||||| |||||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc 46186461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47005154 - 47005209
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| |||||||| |||||||||||||    
47005154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg 47005209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| ||| |||||||||||| |||||||||||||||||||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg 9596813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 221 - 275
Target Start/End: Complemental strand, 30426227 - 30426174
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||||||| |||||||||| |||||||||||||||||||| ||||||||||    
30426227 tggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc 30426174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    |||||||||||||||||||||||||||| ||||||||||||||    
36673072 gtccctgaccccacttttgtgatgatttacatacgtggcacat 36673114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 43440495 - 43440549
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||    
43440495 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct 43440549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 322 - 396
Target Start/End: Original strand, 46901203 - 46901276
Alignment:
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttt 396  Q
    |||| ||||||||||| || |||| |||||||||||||||||| ||||| ||||||||||  |||||||||||||    
46901203 aaaaaagtccctgacctcattttt-tgatgatttgcatacgtgacacatgataactgaactcattttgtagtttt 46901276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 30034353 - 30034304
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||||||||    
30034353 ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt 30034304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||| | |||||||||||| ||||||||||||||||||||||    
31869596 ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg 31869649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
3387268 taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 3387320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||| |||||| |||||||||||||| |||||||||||||||||    
7518444 ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt 7518396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 9603919 - 9603871
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| ||||||||||||||||||| |||||||||||    
9603919 ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 9603871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 19844264 - 19844320
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||| |||||| |||||||||||||||||  ||||||||||||    
19844264 tggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg 19844320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 30130504 - 30130452
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||| |||||| ||||||||| ||||||||||||||| |||||||||||||||    
30130504 ggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc 30130452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||| ||||||| ||||||||||||||||||||||    
49324143 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 49324091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 50261937 - 50261885
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||| |||||||||||||||||||||  || ||||||||||||||    
50261937 tggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc 50261885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 52342195 - 52342243
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| ||||| ||||||||||||||||||| |||||||||||    
52342195 ggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta 52342243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||    
52342473 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa 52342421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 275834 - 275783
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||  |||||||||||| |||||||| ||||||||||||||||    
275834 tggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt 275783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 387
Target Start/End: Complemental strand, 2486785 - 2486734
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||| ||||    
2486785 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2486734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 8555199 - 8555140
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||||||| ||||| ||||  |  |||||||||||||    
8555199 gtccctgaccccacttttgtgatgatttgcacacgtgtcacacgacgactgaaccaattt 8555140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 9596986 - 9596927
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||| ||||||||||||||||||||||| || |||||||| ||||    
9596986 gtccctgtctccacttttgagatgatttgcatacgtggcacatgatgactgaacccattt 9596927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 20405110 - 20405055
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||| ||||||||||||||||||||||||||| ||||| || |||||||| ||||    
20405110 ctgactccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt 20405055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 27681682 - 27681627
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||| | ||| ||||||||||||||||||||||||||| ||||||    
27681682 ggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg 27681627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||||||||  ||||||||||| ||| |||||||||||||||||    
29686870 ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc 29686819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 30034472 - 30034417
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||| |||||||||| ||||||||||||||||||||||    
30034472 ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg 30034417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 30128284 - 30128339
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||| ||| ||||||||||||||||| ||||    
30128284 ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg 30128339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||||||||||||||||||||| || ||||| |||||||||    
30424628 ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc 30424679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 331 - 382
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||||||||||||||||||||||||| | ||||||||| || ||||||||    
36732750 cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 36732801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 40277822 - 40277877
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| | ||||| |||||||||||||||| |||||||||||||| ||||||    
40277822 ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg 40277877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||| ||||||||||  |||||||||||||||||||||    
46622129 ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg 46622074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 47114487 - 47114538
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  |||| ||||||||||||||| ||||||||||||||||||    
47114487 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc 47114538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 51500398 - 51500449
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||| ||| ||||| ||| ||||||||||||||||||||||||||    
51500398 ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc 51500449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 387
Target Start/End: Original strand, 53113496 - 53113551
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||||||| || |||||||| || |||||||| ||||    
53113496 ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacctattt 53113551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||| ||||| |||||||||||||||| ||||||||||||||    
2486900 ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 2486854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 264
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttg 264  Q
    ||||| ||||| |||||||||||||||||||||||||||||||    
25353199 ggctagaatatggttttagtccctgcaaatatgcctcgttttg 25353241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||  |||| ||||||||||||||| |||||||||||||||||    
35177255 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 35177305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 335 - 381
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
335 accccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||||||||||||||||||||||| ||||||||||| || |||||||    
35533393 accccacttttgtgatgatttgcacacgtggcacatgatgactgaac 35533439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 46901104 - 46901154
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||| ||||||||| |||||||||||  ||||||||||||||||    
46901104 ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt 46901154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    |||||||| ||||||||| ||| |||||||| |||||||||||||||||||    
47901803 taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc 47901853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 328 - 370
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 370  Q
    |||| |||||||||||||||||||||||||| |||||||||||    
50009029 gtccatgaccccacttttgtgatgatttgcacacgtggcacat 50009071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| ||||| |||| ||||||||||| ||||||||||||||||||    
8555305 taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc 8555256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||    
9603738 gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac 9603791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 277
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| |||||||| | ||||||||| |||| ||||||||||||||||||    
14772523 ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg 14772470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||| |||||||||| || |||||||| |||||||||||||||||    
16679678 ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc 16679727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 387
Target Start/End: Complemental strand, 16679857 - 16679796
Alignment:
326 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||| || ||||||||||||||||| ||||||||||  || |||||||| ||||    
16679857 tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccattt 16679796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 331 - 380
Target Start/End: Original strand, 28418653 - 28418702
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 380  Q
    |||| ||||||||||||||||||||||| ||||||||||| || ||||||    
28418653 cctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaa 28418702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 35177374 - 35177423
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
35177374 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35177423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 35565627 - 35565676
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||| ||||||||||| || |||||||| ||||    
35565627 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 35565676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||||||||||||||  |||||||| ||||||||||||    
863649 taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg 863597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| |||| |||||||||| ||| ||||||||||||||||||    
1721092 taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg 1721144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||| ||||| ||||||||||||||| ||| |||||||||||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt 2486629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||  || |||||||||| |||||||||||||||||||||||    
8940163 taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg 8940215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||  ||||||||||||||||||||| ||||||| ||||    
10778373 taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg 10778425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 13514577 - 13514525
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||| || |||||||||||| |||||||||||||||||||    
13514577 ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc 13514525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 390
Target Start/End: Original strand, 14772323 - 14772383
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgt 390  Q
    |||| |||||||||||||||||||||| | ||||||||||| || | |||||| |||||||    
14772323 cccttaccccacttttgtgatgatttgtacacgtggcacatgatgattgaacccattttgt 14772383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 28452147 - 28452199
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||| |||||||||| || ||||||||||||||||    
28452147 ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc 28452199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 331 - 387
Target Start/End: Original strand, 35407551 - 35407607
Alignment:
331 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||||||||||||||||||||| | | ||||||||| || |||||||| ||||    
35407551 cctgaccccacttttgtgatgatttgtacaggtggcacatgatgactgaacccattt 35407607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 38232241 - 38232293
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||  |||| ||||||||||||||| ||||||||| |||||||||    
38232241 ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc 38232293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 40370284 - 40370340
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||| |||||||| |||||||| ||||    
40370284 tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg 40370340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||  |||| ||||||||||||||| ||| ||||||||||||||||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg 40545784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #228
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| |||||||||| ||||||||| ||||| |||||||||||||    
40723121 taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc 40723169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #229
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||  |||||||||||||| ||||||||| ||||||||||||    
45005889 taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg 45005941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 243 - 274
Target Start/End: Original strand, 590197 - 590228
Alignment:
243 cctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||||||||||||||||||||||||    
590197 cctgcaaatatgcctcgttttggttttagtcc 590228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 1721196 - 1721255
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| | ||||||||| || | |||||| ||||    
1721196 gtccctggccccacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt 1721255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 3387338 - 3387381
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
3387338 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 3387381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 225 - 272
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||  ||||||| |||||||||||||||| |||||||||||||    
12673978 taaaatatgattttagttcctgcaaatatgcctcattttggttttagt 12673931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 12741016 - 12741071
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
12741016 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 12741071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20405223 - 20405168
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||| | | ||||| |||||||||||||    
20405223 ggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg 20405168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 20644614 - 20644673
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| ||||||||||||||||||||||| | ||||||||| || | |||||| ||||    
20644614 gtccctggccccacttttgtgatgatttgcacatgtggcacatgatgagtgaacccattt 20644673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 20644876 - 20644821
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||| |||||| || ||||||| ||||||||||||    
20644876 ggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg 20644821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 20757775 - 20757724
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||||  ||||| |||||| |||||||| |||||||||||||||||    
20757775 ggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc 20757724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 22008781 - 22008726
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
22008781 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22008726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 22016299 - 22016244
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
22016299 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22016244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 25609767 - 25609822
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||  | |||||| ||||||||||||||||||||||||    
25609767 ggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg 25609822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Complemental strand, 25610022 - 25609963
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| |||||||| |||||||||| | ||||||||||| || |||||||| ||||    
25610022 gtccctgactccacttttctgatgatttgaacacgtggcacatgatgactgaacccattt 25609963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 25610059 - 25610016
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| ||||||||||||||| |||||||||||||| |||||||    
25610059 gttttggtccctgcaaatatgtctcgttttggttttggtccctg 25610016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 29678388 - 29678333
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||||  |||| |||||||||||||||||  ||||||||||||| ||||    
29678388 tggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct 29678333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 29686544 - 29686599
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||| ||||| ||||| |||| |||||||||| || |||||||||||||||||||    
29686544 ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg 29686599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35407790 - 35407735
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| || ||||| |||||||||||||    
35407790 ggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg 35407735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 35498416 - 35498471
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| | |||||||||| ||||||||  |||||||||||||| ||||||    
35498416 ggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg 35498471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 35565581 - 35565624
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||    
35565581 ttttggtccctgcaaatatgcctcattttggttttagtctctgg 35565624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #249
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 39132834 - 39132791
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||| |||||||||||||| ||||||||    
39132834 ttttggtccctgcaaatatgtctcgttttggttttggtccctgg 39132791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #250
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Original strand, 45002130 - 45002185
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
45002130 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 45002185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #251
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Original strand, 45005959 - 45006002
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
45005959 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 45006002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #252
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 45005995 - 45006054
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| ||||    
45005995 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 45006054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #253
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 387
Target Start/End: Complemental strand, 47114701 - 47114646
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||| |||||||||||||||||||| ||||| ||||| || |||||||| ||||    
47114701 ctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt 47114646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #254
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 50009284 - 50009229
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||| ||| ||||| |||| |||||||||||||||||||| ||||| ||||||    
50009284 ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg 50009229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #255
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 272
Target Start/End: Original strand, 52956382 - 52956433
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||| |||| |||||| | |||||| |||||||||||||||||    
52956382 tggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt 52956433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #256
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 278
Target Start/End: Complemental strand, 52956627 - 52956584
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||| ||||||||||||||||||| |||||||||| ||||||||    
52956627 ttttggtccctgcaaatatgcctcattttggttttggtccctgg 52956584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #257
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 269
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttt 269  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||| ||||    
53113443 ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt 53113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
4034790 ttttggtccctgcaaatatgcctcattttggttttggtccctg 4034832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||| |||||||||||||| |||||||    
7957154 ttttggtccctgcaaatatgtctcgttttggttttggtccctg 7957112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
9262081 ttttggtccctgcaaatatgcctcattttggttttggtccctg 9262039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||||| ||||  ||| ||||||| ||||||||||||||||||||||    
11463480 gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc 11463430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #262
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 234 - 272
Target Start/End: Complemental strand, 16123489 - 16123452
Alignment:
234 gttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||| ||||||||||||||||||||||||||||    
16123489 gttttagtcc-tgcaaatatgcctcgttttggttttagt 16123452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #263
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 260
Target Start/End: Complemental strand, 26273824 - 26273786
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgt 260  Q
    ||||||||||| ||||||||||| |||||||||||||||    
26273824 ggctaaaatatggttttagtcccagcaaatatgcctcgt 26273786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #264
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||| ||||| |||||||||||||||  | |||||| ||||||||||||    
28418899 gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg 28418845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #265
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 270
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||| ||||| |||| || |||||||||||||||||||||||    
30034109 ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta 30034155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #266
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 31480391 - 31480337
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||    
31480391 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacc 31480337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #267
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 387
Target Start/End: Complemental strand, 38232498 - 38232440
Alignment:
329 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| |||||||||||||||||| | ||||| ||||| || |||||||| ||||    
38232498 tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt 38232440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #268
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 39071862 - 39071912
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||| ||||||||| | ||||||||| ||||||| ||||||||    
39071862 ggctaaaatatatttttagtccttacaaatatgcttcgttttagttttagt 39071912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #269
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 49670477 - 49670531
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||  ||||||||| |||||||||| || |||||||||||| ||||||||    
49670477 taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggt 49670531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #270
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 235 - 277
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| ||||||||||||||||||| |||||||||| |||||||    
52342509 ttttggtccctgcaaatatgcctcattttggttttggtccctg 52342467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #271
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 54767284 - 54767334
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    ||||||||||||||||||||||||||  ||||| ||||| || ||||||||    
54767284 ctgaccccacttttgtgatgatttgctcacgtgacacatgatgactgaacc 54767334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #272
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 383
Target Start/End: Complemental strand, 8940406 - 8940361
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
8940406 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 8940361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 11463362 - 11463313
Alignment:
338 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    |||||||| |||||||||||| ||||||||||| || |||||||| ||||    
11463362 ccacttttttgatgatttgcacacgtggcacatgatgactgaacccattt 11463313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 19297947 - 19297898
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||||||| |||| || ||||||| ||||||||| ||||||||    
19297947 ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc 19297898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 20644584 - 20644621
Alignment:
241 tccctgcaaatatgcctcgttttggttttagtccctgg 278  Q
    |||||||||||||| |||||||||||||| ||||||||    
20644584 tccctgcaaatatgtctcgttttggttttggtccctgg 20644621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||| |||||||||||||||||||| | || ||||| |||||||||    
20807800 taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc 20807849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||||||||||| ||| |||||||||| ||||||    
28452303 ttttagtccctgcaaatatgtctcattttggttttggtccct 28452262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #278
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 336 - 369
Target Start/End: Complemental strand, 29678270 - 29678237
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcaca 369  Q
    ||||||||||||||||||||||| ||||||||||    
29678270 ccccacttttgtgatgatttgcacacgtggcaca 29678237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #279
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Complemental strand, 33794788 - 33794751
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||  ||||||||||||    
33794788 gtccctgcaaatatgcctcgttttaattttagtccctg 33794751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 35936780 - 35936833
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccc 275  Q
    ||||||||||| ||||| |||||| ||||||| | |||||||||||||| ||||    
35936780 ggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc 35936833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 272
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||| ||||| ||||||||||||||| ||  |||||||||||||    
36673244 gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt 36673195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #282
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 381
Target Start/End: Complemental strand, 39132798 - 39132745
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||| ||||||||||||||||||||||| ||||| | ||| || |||||||    
39132798 gtccctggccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac 39132745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #283
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 40370465 - 40370420
Alignment:
342 ttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||| ||||||||||| || |||||||| ||||    
40370465 ttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 40370420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #284
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||||||| |||||||||| ||||||    
40370515 ttttggtccctgcaaatatgcctcattttggttttggtccct 40370474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #285
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 40560492 - 40560529
Alignment:
240 gtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||||||||||||||  ||||||||||||    
40560492 gtccctgcaaatatgcctcgttttaattttagtccctg 40560529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #286
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatg 254  Q
    ||||||||||| |||||||||||||||||||||    
26800169 ggctaaaatatggttttagtccctgcaaatatg 26800137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #287
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 364
Target Start/End: Original strand, 27681426 - 27681462
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtg 364  Q
    |||||||| |||||||||||||||||||||| |||||    
27681426 gtccctgatcccacttttgtgatgatttgcacacgtg 27681462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #288
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 36672966 - 36673014
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||| ||||||||||| || |||||||||||||||    
36672966 taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc 36673014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #289
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| |||||||||  ||||||||||  |||||||||||||||| ||||    
45521833 taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg 45521781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #290
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 383
Target Start/End: Complemental strand, 49324026 - 49323982
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    |||||||||||| ||||||| ||||||||||| || |||||||||    
49324026 cacttttgtgataatttgcacacgtggcacatgatgactgaacca 49323982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #291
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Original strand, 51058593 - 51058645
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||||||| |||| ||||||| ||||||||  |||||||||||    
51058593 taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctg 51058645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #292
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 381
Target Start/End: Original strand, 51058703 - 51058751
Alignment:
333 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    |||| ||||||||||||||||||||||| ||| ||||| || |||||||    
51058703 tgactccacttttgtgatgatttgcatatgtgacacatgatgactgaac 51058751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #293
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 392
Target Start/End: Complemental strand, 53719214 - 53719154
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    |||||| |||||||||||||||||||| |||||  |||| || |||||| | |||||||||    
53719214 ctgacctcacttttgtgatgatttgcacacgtgatacatgatgactgaatccattttgtag 53719154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #294
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 54767524 - 54767472
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||  ||||||| ||||||||| ||||||||||||    
54767524 taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctg 54767472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 8547 - 8727
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
8547 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaattttttgttt 8646  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8647 ttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 8727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 1644 - 1464
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    |||||||||||   ||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||              
1644 ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaattttttgttt 1545  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
1544 ttgaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaattttgtagtttttgg 1464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 1311 - 1368
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||    
1311 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt 1368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 12182 - 12362
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||             |||||||||||||||||||||              
12182 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttgttt 12281  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
12282 ttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttgg 12362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 12537 - 12484
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||    
12537 tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc 12484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 5708 - 5527
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn----ttgtttttggtccctgcaaaannnnnnnnn 317  Q
    ||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||            |||||||||||||||||||||             
5708 ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgtt 5609  T
318 nnngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5608 tttgaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 5527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 5399 - 5456
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||    
5399 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggt 5456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 14697 - 14875
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg-gtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |          |  |||||||||||| ||||                
14697 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgttttggtccctgtaaaattttttgttttt 14796  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14797 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 14875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 15012 - 14957
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||    
15012 ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg 14957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 222 - 398
Target Start/End: Complemental strand, 9028 - 8850
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||| |||||              
9028 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaattttttgttt 8929  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 398  Q
      |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8928 ttgaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttg 8850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 8734 - 8787
Alignment:
224 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 8787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 366273 - 366097
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |        |||||||||||||||||||||                 
366273 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg-taaaaaaaattgtttttggtccctgcaaaattttttgtttttt 366175  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||| ||||||| ||||||||||||||| ||||||||||||| || |||||||| ||||||||||||||||    
366174 aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacctattttgtagtttttgg 366097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 365979 - 366034
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg 366034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 392
Target Start/End: Original strand, 5209 - 5382
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||             ||||||||||||||| |||||              
5209 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt 5308  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
      |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5309 ttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 392
Target Start/End: Original strand, 5229 - 5402
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn---ttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||             ||||||||||||||| |||||              
5229 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattttgttt 5328  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
      |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5329 ttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 5402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 221 - 399
Target Start/End: Complemental strand, 4313 - 4134
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnn 319  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||          || |||||| ||||||||||||               
4313 tggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaatttgtttttcgtccctgcaaaattttttgtttt 4214  T
320 ngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
      ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
4213 taaaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttgtagtttttgg 4134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 277
Target Start/End: Original strand, 4016 - 4064
Alignment:
229 atatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||||    
4016 atatggttttagtccctacaaatatgcctcgttttggttttagtccctg 4064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 10168 - 10335
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||||||||||   ||          |||||||||||||||||||            |    
10168 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct--gtaa--------gtttttggtccctgcaaaattttttgtttttg 10257  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
10258 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaattttgtagtttttgg 10335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 10515 - 10460
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||||||||||||||| || |||||||||||||| ||||    
10515 ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg 10460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 3291 - 3113
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnntt-gtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||          || ||||||||| |||||||||                
3291 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatttgtttttggtacctgcaaaattttttgttttt 3192  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||    
3191 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaattttgtagtttttgg 3113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 321 - 399
Target Start/End: Complemental strand, 17942 - 17864
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||    
17942 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaattttgtagtttttgg 17864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 18043 - 17988
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||    
18043 ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg 17988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 2778 - 2955
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||                 
2778 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgtttttggtccctgcaaaattttttgtttttc 2877  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||||  || |||| ||| | ||||||||||||||    
2878 aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcacaagatgactggacccaatttgtagtttttgg 2955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 321 - 388
Target Start/End: Complemental strand, 35170 - 35103
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 388  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35170 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt 35103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 279
Target Start/End: Original strand, 34930 - 34988
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||    
34930 tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt 34988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 63; Significance: 3e-27; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 222 - 399
Target Start/End: Original strand, 94057 - 94237
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg---tnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnn 318  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||    |        ||||||||||||||||||||               
94057 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaatttttttgttt 94156  T
319 nngaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
       |||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||    
94157 tttaaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttgtagtttttgg 94237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
223 gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    |||||||||| |||||||||||| ||||||||||||||||||||||||    
94329 gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 222 - 399
Target Start/End: Complemental strand, 3918 - 3741
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnng 321  Q
    ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||          ||||||||||||| |||||||                 
3918 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaacttttttttgtttttggtccttgcaaaattttttgtttttt 3819  T
322 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||| | || |||||| |||||||||||||||||||||| || ||| |||  ||||||||||||||||    
3818 aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacatgatgactaaactgattttgtagtttttgg 3741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 3531 - 3584
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
3531 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 3584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 222 - 397
Target Start/End: Complemental strand, 24657 - 24482
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtnnnnnnnn-ttgtttttggtccctgcaaaannnnnnnnnnnn 320  Q
    |||||||||||| ||||||||| | |||||||||||||||||| ||||||||||||           |||||||||||||||||||||                
24657 ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaattgtttttggtccctgcaaaattttttgttttt 24559  T
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagttttt 397  Q
    |||||||||| |||||||  || ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||    
24558 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaattttgtagttttt 24482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 24372 - 24427
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||    
24372 ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg 24427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 55; Significance: 2e-22; HSPs: 3)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 321 - 399
Target Start/End: Original strand, 8432 - 8510
Alignment:
321 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttgtagtttttgg 399  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||| || |||||||| |||||||| |||||||    
8432 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccattttgtaatttttgg 8510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 8330 - 8382
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||    
8330 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 8382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 8642 - 8590
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||    
8642 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc 8590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 48; Significance: 3e-18; HSPs: 5)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 54815 - 54870
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
54815 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 54870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 50023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 55124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 49969 - 49914
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||| ||||||||||||| |||||||  |||||||||| || |||||||||    
49969 gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca 49914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 383
Target Start/End: Complemental strand, 55070 - 55015
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 383  Q
    ||||||||| ||||||||||||| |||||||  |||||||||| || |||||||||    
55070 gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca 55015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 82706 - 82651
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
82706 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 82651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 82341 - 82396
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||| | ||||||||||||||||||||||    
82341 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 82396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 82450 - 82509
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| |||||||||    
82450 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt 82509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 75764 - 75709
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||    
75764 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 75709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 75359 - 75414
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  |||||||||||||| ||||||||||||||||||||||    
75359 ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg 75414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 12524 - 12577
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    |||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
12524 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc 12577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 46; Significance: 4e-17; HSPs: 6)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 4041 - 4098
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||    
4041 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt 4098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 19223 - 19280
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||    
19223 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt 19280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 4288 - 4231
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||| ||||    
4288 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt 4231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 19470 - 19413
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt 279  Q
    ||||||||||| |||||| |||||||||||||| ||||||||||||||||||| ||||    
19470 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt 19413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 4128 - 4175
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggcacattataact 377  Q
    |||||||||||||| || ||||||||||||||||||||||||||||||    
4128 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 4175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 19310 - 19357
Alignment:
330 ccctgaccccacttttgtgatgatttgcatacgtggcacattataact 377  Q
    |||||||||||||| || ||||||||||||||||||||||||||||||    
19310 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 19357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 221 - 277
Target Start/End: Complemental strand, 17967 - 17911
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||    
17967 tggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg 17911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 17863 - 17791
Alignment:
322 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacattataactgaaccaattttgtag 392  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||| ||||  | |||||||  |||||||||    
17863 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacatggtgactgaactcattttgtag 17791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 221 - 272
Target Start/End: Complemental strand, 3456 - 3405
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||||    
3456 tggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 27364 - 27309
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
27364 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 27309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 277
Target Start/End: Original strand, 27072 - 27114
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    |||| |||||||||||||||||||||||||||||| |||||||    
27072 ttttggtccctgcaaatatgcctcgttttggttttggtccctg 27114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 44; Significance: 6e-16; HSPs: 5)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 47925 - 47980
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
47925 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
225 taaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    |||||||| ||||| ||||||||||||||||||| ||||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc 48180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 358
Target Start/End: Original strand, 47972 - 48004
Alignment:
326 tagtccctgaccccacttttgtgatgatttgca 358  Q
    |||||||||||||||||||||||||||||||||    
47972 tagtccctgaccccacttttgtgatgatttgca 48004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 223172 - 223120
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| ||||||||||||||| |||  ||||||||||||||    
223172 ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc 223120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 222884 - 222925
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
222884 ttttggtccctgcaaatatgtctcgttttggttttggtccct 222925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 148227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 339 - 382
Target Start/End: Original strand, 148007 - 148050
Alignment:
339 cacttttgtgatgatttgcatacgtggcacattataactgaacc 382  Q
    |||||||||||||||||||| ||||||||||| || ||||||||    
148007 cacttttgtgatgatttgcacacgtggcacatgatgactgaacc 148050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Complemental strand, 2660 - 2606
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||    
2660 ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct 2606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 2412 - 2463
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||| ||||    
2412 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt 2463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Original strand, 2334 - 2382
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||| ||||| ||||| |||||||||||||| ||| ||||||||||||    
2334 ggctataatatggttttggtccctgcaaatattccttgttttggtttta 2382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 22055 - 22003
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc 274  Q
    ||||||||||| ||||| |||||| ||||| ||||||||||||||||||||||    
22055 ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc 22003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 387
Target Start/End: Original strand, 21807 - 21858
Alignment:
336 ccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||||||||||||||||| ||||||||| | || | |||||||||||    
21807 ccccacttttgtgatgatttgcacacgtggcacgtgatgattgaaccaattt 21858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 276
Target Start/End: Original strand, 21763 - 21804
Alignment:
235 ttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||| ||||||||||||||| |||||||||||||| ||||||    
21763 ttttggtccctgcaaatatgtctcgttttggttttggtccct 21804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 16723 - 16779
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||||  |||| ||||||||||||||  ||||||||||||||||||||||    
16723 tggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg 16779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 387
Target Start/End: Original strand, 16832 - 16891
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt 387  Q
    ||||||||| ||||||||||||||||||||| | ||||||||| || |||||||| ||||    
16832 gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacccattt 16891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 37; Significance: 0.000000000009; HSPs: 3)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 189678 - 189630
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||||||||| ||| ||||||||||||||| |||||||||||    
189678 ggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta 189630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 189329 - 189379
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 272  Q
    |||||||||||||||||  | |||| |||||||||||||||||||||||||    
189329 ggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt 189379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 328 - 367
Target Start/End: Original strand, 189437 - 189476
Alignment:
328 gtccctgaccccacttttgtgatgatttgcatacgtggca 367  Q
    ||||||| ||||||||||||||||||||||| ||||||||    
189437 gtccctggccccacttttgtgatgatttgcacacgtggca 189476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 222 - 277
Target Start/End: Original strand, 3752 - 3807
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| ||||| |||||||||||||||| | |||||||||||| ||||||    
3752 ggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg 3807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 273
Target Start/End: Complemental strand, 4079 - 4028
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc 273  Q
    ||||||||||  ||||| ||||||||||||||| |||||||| |||||||||    
4079 ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc 4028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 36; Significance: 0.00000000004; HSPs: 3)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 221 - 276
Target Start/End: Complemental strand, 2884 - 2829
Alignment:
221 tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    |||||||||||| ||||| ||||||||||||||| |||||||||  ||||||||||    
2884 tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct 2829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 2501 - 2555
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct 276  Q
    ||||||||||| |||||  ||||||||||||||| |||||||| |||||||||||    
2501 ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct 2555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 2615 - 2664
Alignment:
332 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 381  Q
    ||||||||||||||||||| ||||||| ||||||||||| || |||||||    
2615 ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac 2664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 222 - 277
Target Start/End: Complemental strand, 35084 - 35029
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 277  Q
    ||||||||||| |||||  ||| | |||||||| ||||||||||||||||||||||    
35084 ggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg 35029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
222 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 270  Q
    ||||||||||| | ||| |||||||||||||||| || |||||||||||    
44206 ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta 44158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University