View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_low_23 (Length: 304)
Name: NF0626_low_23
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0626_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 78 - 217
Target Start/End: Complemental strand, 49069548 - 49069409
Alignment:
| Q |
78 |
agcacagataaatactaagctttgtgataagttttctgttggtcattatcctatgctcttttggggccctcctcctaaatttgtaggcggtagttgggaa |
177 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49069548 |
agcacagataaatattaagctttgtgataagttttctgttggtcattatcctatgctcttttggggccctcctcctaaatttgtaggcggtagttgggaa |
49069449 |
T |
|
| Q |
178 |
cctaaacaagagaaaagtgatatacatgtgattgatgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49069448 |
cctaaacaagagaaaagtgatatacatgtgattgatgatg |
49069409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2715 times since January 2019
Visitors: 4011