View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_low_26 (Length: 298)
Name: NF0626_low_26
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0626_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 212
Target Start/End: Complemental strand, 14060131 - 14059926
Alignment:
| Q |
7 |
tagacgacccactacatctttcatttgcatgcgggaatgtcatttcttaagatttttcatcactttatagttccatctttatgttaaattaaagctgcaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14060131 |
tagacgacccactacatctttcatttgcatgcgggaatgtcatttcttaagatttttcatcactttatagttccatctttatgttaaattaaagctgcaa |
14060032 |
T |
|
| Q |
107 |
gcaaaaaagtgaaaccaaagcaaaacaattattttagggaagcatgcaatggtgttagcattaccatttaaagctaatgcttaactgctacataaccatg |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14060031 |
gtaaaaaagtgaaaccaaagcaaaacaattattttagggaagcatgcaatggtgttagcattaccatttaaagctaatgcttaactgctacataaccatg |
14059932 |
T |
|
| Q |
207 |
atttaa |
212 |
Q |
| |
|
|||||| |
|
|
| T |
14059931 |
atttaa |
14059926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 209 - 296
Target Start/End: Complemental strand, 5054097 - 5054010
Alignment:
| Q |
209 |
ttaaaatttcatgttggccatcttttagcataaattgttaaaattttgtgttggtggcccttccaagttttcttttctttcctttcat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5054097 |
ttaaaatttcatgttggccatcttttagcataaattgttaaaattttgtgttggtggcccttccaagttttcttttctttcctttcat |
5054010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2681 times since January 2019
Visitors: 4010