View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_low_28 (Length: 285)
Name: NF0626_low_28
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0626_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 239
Target Start/End: Complemental strand, 31495068 - 31494859
Alignment:
Q |
30 |
acaatgtgattccaattaggaggagattggtggaaaagacagaagtgatgattttatttaagaattcaaagttggagattttgaaattgaaaaataaagc |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
31495068 |
acaatgtgattccaattaggaggagattggtggaaaagacagaagtgatgattttatttaagaattcaaagttggagattttggaattgaaaaataaagc |
31494969 |
T |
 |
Q |
130 |
tgaaaatcatagattggaaagaagtaggcttgagagtatttttatgagtttccaaatgagggctgaaagagaaggaatgaatatggttaggttgcttggt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31494968 |
tgaaaatcatagattggaaagaagtaggcttgagagtattgttatgagtttccaaatgagggctgaaagagaaggaatgaatatggttaggttgcttggt |
31494869 |
T |
 |
Q |
230 |
gaagttgatc |
239 |
Q |
|
|
|||||||||| |
|
|
T |
31494868 |
gaagttgatc |
31494859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University