View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_low_36 (Length: 266)
Name: NF0626_low_36
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0626_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 45 - 248
Target Start/End: Complemental strand, 10446195 - 10445993
Alignment:
| Q |
45 |
agttgttacttcatattcaataattacagacttatgaaagaaactagaatgctaagttaattattggcttgcttattatcatcatttgcgtaaaagaaat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10446195 |
agttgttacttcatattcaataattacagacttatgaaagaaactagaatgctaagttaattattggcttgcttattatcatcatttgcgtaaaagaaat |
10446096 |
T |
|
| Q |
145 |
tgacatatttgctctaaagttttttattaacgtaaccaagttctagtaaaagggacatgccaccatacaatccagttgtcatattgatattttcttttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10446095 |
tgacatatttgctctaaagttttttattaacgtaaccaagttctagtaaaagggacatgccaccatacaatccagttgtcatattgatatttt-ttttct |
10445997 |
T |
|
| Q |
245 |
ctcg |
248 |
Q |
| |
|
|||| |
|
|
| T |
10445996 |
ctcg |
10445993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3299 times since January 2019
Visitors: 4031