View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0626_low_9 (Length: 442)
Name: NF0626_low_9
Description: NF0626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0626_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 69 - 210
Target Start/End: Original strand, 11202508 - 11202649
Alignment:
Q |
69 |
gggtgagggattcgctatctacgaagatgataaaggagcagcaagaggagagtggtcgcatcagaaaagctattgcttcaaggtttgattttgataaatt |
168 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11202508 |
gggtgagggattcgctatctacgaagatgataaaggagcagcaagaggagagtggtcgcatcagaaaagctattgcttcaaggtttgattttgataaatt |
11202607 |
T |
 |
Q |
169 |
tgatacattattcattaattgcctgtgttatgttatgttgtg |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11202608 |
tgatacattattcattaattgcctgtgttatgttatgttgtg |
11202649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 310 - 418
Target Start/End: Original strand, 11202749 - 11202857
Alignment:
Q |
310 |
aattgaataattgaagcaatgggttgtgtttattttgatttcaatgtgactcttttggctaaattgactgatttgggtgtgttatttagggttaaattgg |
409 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11202749 |
aattgaataattgaagcaatgggttgtgtttattttgatttcaatgtgactcttttggctaaattgactgatttgggtgtgttatttagggttaaattgg |
11202848 |
T |
 |
Q |
410 |
atggtgatg |
418 |
Q |
|
|
||||||||| |
|
|
T |
11202849 |
atggtgatg |
11202857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2797 times since January 2019
Visitors: 4015