View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627-Insertion-3 (Length: 135)
Name: NF0627-Insertion-3
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627-Insertion-3 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 14 - 135
Target Start/End: Original strand, 39625594 - 39625716
Alignment:
| Q |
14 |
tttgtaagctaatactaattttgatgaataactaggtctttcgatcttagtttaaatttccttaaatag-ttgttaggtgattactggttagttatgata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39625594 |
tttgtaagctaatactaattttgatgaataactaggtctttcgatcttagtttaaatttccttaaatagtttgttaggtgattactggttagttatgata |
39625693 |
T |
|
| Q |
113 |
acactagaacttctttttcccta |
135 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
39625694 |
acactagaacttcttttttccta |
39625716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 14 - 135
Target Start/End: Original strand, 39635144 - 39635266
Alignment:
| Q |
14 |
tttgtaagctaatactaattttgatgaataactaggtctttcgatcttagtttaaatttccttaaatag-ttgttaggtgattactggttagttatgata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39635144 |
tttgtaagctaatactaattttgatgaataactaggtctttcgatcttagtttaaatttccttaaatagtttgttaggtgattactggttagttatgata |
39635243 |
T |
|
| Q |
113 |
acactagaacttctttttcccta |
135 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
39635244 |
acactagaacttcttttttccta |
39635266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2563 times since January 2019
Visitors: 4010