View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_high_28 (Length: 232)
Name: NF0627_high_28
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_high_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 232
Target Start/End: Original strand, 4315213 - 4315430
Alignment:
| Q |
15 |
gagatgaagtaggcgcgtggaccagtcgccaggtgcagcgcgtgagcgtttgctacgtgcttttcctggtagaggtgtttctggacggagaaatgaagcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315213 |
gagatgaagtaggcgcgtggaccagtcgccaggtgcagcgcgtgagcgtttgctacgtgcttttcctggtagaggtgtttctggacggagaaatgaagcg |
4315312 |
T |
 |
| Q |
115 |
ttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccggagagaagtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315313 |
ttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccggagagaagtt |
4315412 |
T |
 |
| Q |
215 |
gcaatgttttcaattctt |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4315413 |
gcaatgttttcaattctt |
4315430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University