View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_14 (Length: 380)
Name: NF0627_low_14
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_14 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 104 - 367
Target Start/End: Original strand, 25568 - 25828
Alignment:
| Q |
104 |
actaaatatcccattatataaaaatttattatatatctaaataaatatggttgagaaattcatgata-taaagttattgnnnnnnntgtgagaagaattt |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||| || |||||| |||||||| ||||||||||||||| | | ||| ||||||| |||||||||||||| |
|
|
| T |
25568 |
actaaatatcccattatacaaaaatttactagatatcttaataaataaggttgagaaattcataaaaataaggttattgaaaacaatgtgagaagaattt |
25667 |
T |
|
| Q |
203 |
cattttgaatagttgagaaagcaaaaaacaggagtnnnnnnnggactaagaattgaacttactatgtaccaacaaccctctctgtgcttgcctcagtttc |
302 |
Q |
| |
|
|| || ||||| | |||||||||||| ||||||| || ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25668 |
caattcgaatactc-agaaagcaaaaagcaggagtaaaa---ggcctaagaactgaacttactatgtaccaacaactctctctgtgcttgcctcagtttc |
25763 |
T |
|
| Q |
303 |
cttgcctccaactattcttgctagtccaaaatctgagattttcggttgcatctcctcgtctagaa |
367 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25764 |
tttccctccaactattcttgctagtccaaaatctgagattttcggttgcatctcctcgtctagaa |
25828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 253 - 367
Target Start/End: Original strand, 21917881 - 21917995
Alignment:
| Q |
253 |
aattgaacttactatgtaccaacaaccctctctgtgcttgcctcagtttccttgcctccaactattcttgctagtccaaaatctgagattttcggttgca |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||| | ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
21917881 |
aattgaacttactatgtaccaacaaccctctctgtgcttgcctctgtttctttgcctgcaaatgttcttgctattccaaaatctgagatttttggttgca |
21917980 |
T |
|
| Q |
353 |
tctcctcgtctagaa |
367 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
21917981 |
tctcctcatctagaa |
21917995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3282 times since January 2019
Visitors: 4031