View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_17 (Length: 338)
Name: NF0627_low_17
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0627_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 98 - 277
Target Start/End: Complemental strand, 43802278 - 43802099
Alignment:
Q |
98 |
tcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgttcgatcaac |
197 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43802278 |
tcatgagctctgataaagcccactccacaaccgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgttcgatcaac |
43802179 |
T |
 |
Q |
198 |
gacatgggttttttcgtcagagagatcgatcggttggtgcatcagtgagagtagaatgtctacgaaatccctatgcttct |
277 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
T |
43802178 |
gacatgggttttttcgtcagagggatcgatcggttggtgcatcagtgagagtagaatgtctacgaagtccttatgcttct |
43802099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 98 - 259
Target Start/End: Complemental strand, 43812847 - 43812686
Alignment:
Q |
98 |
tcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgttcgatcaac |
197 |
Q |
|
|
|||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| |||| |||||||||| || |||||||||||||||||||||||||| |
|
|
T |
43812847 |
tcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggcgatcatgtctaaggctatagcctttatgtttgttcgatcaat |
43812748 |
T |
 |
Q |
198 |
gacatgggttttttcgtcagagagatcgatcggttggtgcatcagtgagagtagaatgtcta |
259 |
Q |
|
|
||||||| ||| |||||||||| |||| |||| |||||| ||||||||||||||||||||| |
|
|
T |
43812747 |
gacatggctttgttcgtcagagggatcaatcgtctggtgcgtcagtgagagtagaatgtcta |
43812686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University