View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_23 (Length: 300)
Name: NF0627_low_23
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 108 - 235
Target Start/End: Complemental strand, 734347 - 734220
Alignment:
| Q |
108 |
gttcctcatttgcagcctcagattgtgattgctgtccttaaagttcacatgcattgtgaagcttgtgcagaggagatcaaaaaacggatacttaaaatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
734347 |
gttcctcatttgcagcctcagattgtgattactgtccttaaagttcacatgcattgtgaagcttgtgcagaggaaatcaaaaaacggatacttaaaatga |
734248 |
T |
|
| Q |
208 |
atggtactgtccaattccaatatttaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
734247 |
atggtactgtccaattccaatatttaac |
734220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 108 - 235
Target Start/End: Complemental strand, 45390740 - 45390613
Alignment:
| Q |
108 |
gttcctcatttgcagcctcagattgtgattgctgtccttaaagttcacatgcattgtgaagcttgtgcagaggagatcaaaaaacggatacttaaaatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45390740 |
gttcctcatttgcagcctcagattgtgattactgtccttaaagttcacatgcattgtgaagcttgtgcagaggaaatcaaaaaacggatacttaaaatga |
45390641 |
T |
|
| Q |
208 |
atggtactgtccaattccaatatttaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45390640 |
atggtactgtccaattccaatatttaac |
45390613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 114 - 222
Target Start/End: Complemental strand, 45386373 - 45386268
Alignment:
| Q |
114 |
catttgcagcctcagattgtgattgctgtccttaaagttcacatgcattgtgaagcttgtgcagaggagatcaaaaaacggatacttaaaatgaatggta |
213 |
Q |
| |
|
|||||||||||||||||||||| || ||| |||| |||||||||||||||||||||||||| ||||||| |||||| ||||||| |||||||| |||| |
|
|
| T |
45386373 |
catttgcagcctcagattgtgactgttgt---taaaattcacatgcattgtgaagcttgtgcacaggagataaaaaaaaggatactgaaaatgaagggta |
45386277 |
T |
|
| Q |
214 |
ctgtccaat |
222 |
Q |
| |
|
|||| |||| |
|
|
| T |
45386276 |
ctgtacaat |
45386268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2898 times since January 2019
Visitors: 4018