View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_30 (Length: 272)
Name: NF0627_low_30
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 28 - 227
Target Start/End: Complemental strand, 16352957 - 16352758
Alignment:
| Q |
28 |
agatgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaaggg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352957 |
agatgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaaggg |
16352858 |
T |
|
| Q |
128 |
ttgaatctcagtggatcctgcaggaagctacttctttgaatgttattgatggagaaggatcaaagtgtagcacttttatatagttcaatatgcatatatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352857 |
ttgaatctcagtggatcctgcaggaagctacttctttgaatgttattgatggagaaggatcaaagtgtagcacttttatatagttcaatatgcatatatt |
16352758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3548 times since January 2019
Visitors: 4037