View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_34 (Length: 261)
Name: NF0627_low_34
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 32 - 261
Target Start/End: Original strand, 4093773 - 4094002
Alignment:
| Q |
32 |
tttgccttggacagttggaggtgaaactaaatctttaatgttatcaacaaatagtgtttatgttactaagtggtattcactattcattttatggcaatga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093773 |
tttgccttggacagttggaggtgaaactaaatctttaatgttatcaacaaatagtgtttatgttactaagtggtattcactattcattttatggcaatga |
4093872 |
T |
 |
| Q |
132 |
gcattatgtagaaccaaagttgagaaaggaataagaacacaacacctcagtatcaaggttagaggttgaaaatgaagagaaactagtggatggcatgtgc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093873 |
gcattatgtagaaccaaagttgagaaaggaataagaacacaacacctcagtatcaaggttagaggttgaaaatgaagagaaactagtggatggcatgtgc |
4093972 |
T |
 |
| Q |
232 |
aattgatatggtttcattgaagaggcttcc |
261 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
4093973 |
aattgatatggtttcattgaagaagcttcc |
4094002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University