View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0627_low_35 (Length: 261)

Name: NF0627_low_35
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0627_low_35
NF0627_low_35
[»] chr8 (1 HSPs)
chr8 (1-232)||(26825467-26825698)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 26825698 - 26825467
Alignment:
1 cagcatatatcttcaaccatatatgcacttctatcagagaaggaatcaaatggaagaagagtgtgccttatacaagactaatttcagagattctgtatca 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26825698 cagcatatatcttcaaccatatgtgcacttctatcagagaaggaatcaaatggaagaagagtgtgccttatacaagactaatttcagagattctgtatca 26825599  T
101 aggaagattacttcaaaaggtgcaagacttaggagtttcttctgatgaggagctaggaacaaagactggtaaagtggttaatggaacgatgttggggttc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26825598 aggaagattacttcaaaaggtgcaagacttaggagtttcttctgatgaggagctaggaacaaagactggtaaggtggttaatggaacgatgttggggttc 26825499  T
201 atgaaaataatttggaagatggatgtgataat 232  Q
    ||||||||||||||||||||||||||||||||    
26825498 atgaaaataatttggaagatggatgtgataat 26825467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3566 times since January 2019
Visitors: 4037