View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_35 (Length: 261)
Name: NF0627_low_35
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 26825698 - 26825467
Alignment:
| Q |
1 |
cagcatatatcttcaaccatatatgcacttctatcagagaaggaatcaaatggaagaagagtgtgccttatacaagactaatttcagagattctgtatca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825698 |
cagcatatatcttcaaccatatgtgcacttctatcagagaaggaatcaaatggaagaagagtgtgccttatacaagactaatttcagagattctgtatca |
26825599 |
T |
|
| Q |
101 |
aggaagattacttcaaaaggtgcaagacttaggagtttcttctgatgaggagctaggaacaaagactggtaaagtggttaatggaacgatgttggggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26825598 |
aggaagattacttcaaaaggtgcaagacttaggagtttcttctgatgaggagctaggaacaaagactggtaaggtggttaatggaacgatgttggggttc |
26825499 |
T |
|
| Q |
201 |
atgaaaataatttggaagatggatgtgataat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26825498 |
atgaaaataatttggaagatggatgtgataat |
26825467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3566 times since January 2019
Visitors: 4037