View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_40 (Length: 252)
Name: NF0627_low_40
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 734740 - 734555
Alignment:
| Q |
15 |
tatgcatcattttatatcatgacattagtatatgtcttgtttttgaggtaaaagataggataagatctgaattcttggttaatatgattcttgtgacaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
734740 |
tatgcatcattttatatcatgacattagtatatgtcatgtttttgaggtaaaagataggataagatctgaattcttggttaatatgattcttgtgacaaa |
734641 |
T |
|
| Q |
115 |
tgagaatgcattaaaatatattaggccatgtttg----tttgctgagattggttattaacttcaaaaagttaaagataatgtatga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
734640 |
tgagaatgcattaaaatatattaggccatgtttgtttgtttgccgagattggttattaacttcaaaaatttaaagataatgtatga |
734555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3611 times since January 2019
Visitors: 4038