View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0627_low_43 (Length: 232)

Name: NF0627_low_43
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0627_low_43
NF0627_low_43
[»] chr8 (1 HSPs)
chr8 (15-232)||(4315213-4315430)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 232
Target Start/End: Original strand, 4315213 - 4315430
Alignment:
15 gagatgaagtaggcgcgtggaccagtcgccaggtgcagcgcgtgagcgtttgctacgtgcttttcctggtagaggtgtttctggacggagaaatgaagcg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4315213 gagatgaagtaggcgcgtggaccagtcgccaggtgcagcgcgtgagcgtttgctacgtgcttttcctggtagaggtgtttctggacggagaaatgaagcg 4315312  T
115 ttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccggagagaagtt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4315313 ttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccggagagaagtt 4315412  T
215 gcaatgttttcaattctt 232  Q
    ||||||||||||||||||    
4315413 gcaatgttttcaattctt 4315430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3458 times since January 2019
Visitors: 4035