View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0627_low_45 (Length: 219)

Name: NF0627_low_45
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0627_low_45
NF0627_low_45
[»] chr6 (1 HSPs)
chr6 (76-131)||(14498395-14498450)


Alignment Details
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 76 - 131
Target Start/End: Complemental strand, 14498450 - 14498395
Alignment:
76 cagaagtatttatataaacatgaaaatacttgtataatcacaaccatttagaatta 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14498450 cagaagtatttatataaacatgaaaatacttgtataatcacaaccatttagaatta 14498395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University