View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_49 (Length: 213)
Name: NF0627_low_49
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 25011720 - 25011522
Alignment:
| Q |
13 |
tgagatgga-catcatcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaaggg |
111 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011720 |
tgagatggatcataatcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaaggg |
25011621 |
T |
|
| Q |
112 |
attcttcactctgtgagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcactt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011620 |
attcttcactctgtgagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcactt |
25011522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3553 times since January 2019
Visitors: 4037