View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_50 (Length: 212)
Name: NF0627_low_50
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0627_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 45 - 135
Target Start/End: Original strand, 48948778 - 48948868
Alignment:
| Q |
45 |
tttgtcctctatgtcgctgtctcttttctcacatctactttgtgtctttgtcgtcacgagggctttatttgtagttgatgatgtccatctc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
48948778 |
tttgtcctctatgtcgctgtctcttttctcacatctactttgtgtctttgtcgtcacgagggctttatttgtagttgattatttccatctc |
48948868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University