View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0627_low_50 (Length: 212)

Name: NF0627_low_50
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0627_low_50
NF0627_low_50
[»] chr1 (1 HSPs)
chr1 (45-135)||(48948778-48948868)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 45 - 135
Target Start/End: Original strand, 48948778 - 48948868
Alignment:
45 tttgtcctctatgtcgctgtctcttttctcacatctactttgtgtctttgtcgtcacgagggctttatttgtagttgatgatgtccatctc 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||    
48948778 tttgtcctctatgtcgctgtctcttttctcacatctactttgtgtctttgtcgtcacgagggctttatttgtagttgattatttccatctc 48948868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University