View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0627_low_51 (Length: 211)
Name: NF0627_low_51
Description: NF0627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0627_low_51 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 86 - 211
Target Start/End: Original strand, 4315305 - 4315430
Alignment:
Q |
86 |
atgaagcgttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccgga |
185 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4315305 |
atgaagcgttacgagcggtttcgtcagtggaaaatgacggaagtgtgtcggtggaagatgaagattccggtgtttgcggtttaaccgcaccggcgccgga |
4315404 |
T |
 |
Q |
186 |
gagaagttgcaatgttttcaattctt |
211 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
4315405 |
gagaagttgcaatgttttcaattctt |
4315430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University