View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_high_6 (Length: 253)
Name: NF0628_high_6
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0628_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 31088551 - 31088757
Alignment:
Q |
16 |
agagaagtgggttcactttcgttgattcgtggataggattatgttcaacccacactctcaataagtaacccttaaatcttatagtctcgagnnnnnnncc |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
31088551 |
agagaagtgggttcactttcgttgattcgtggatacaattatgttcaacccacactctcaataagtaacccttaaatcttatagtctcgagtttttttcc |
31088650 |
T |
 |
Q |
116 |
agtctcttgaatgttgaggctggctgtgtcattttcgataaatgggttgaagtagcaatgcaatgtcacatagaggatctttatatatacttggttaacg |
215 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
31088651 |
agactcttgaatgttgaggctggctgtgtcattttcgataaatgggttgaagtagcaatgcaacgtcacatagaggatctttatatatacttggttaacg |
31088750 |
T |
 |
Q |
216 |
tccattt |
222 |
Q |
|
|
||||||| |
|
|
T |
31088751 |
tccattt |
31088757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 31088461 - 31088497
Alignment:
Q |
24 |
gggttcactttcgttgattcgtggataggattatgtt |
60 |
Q |
|
|
||||||||||||||||||||||||||| |||||||| |
|
|
T |
31088461 |
gggttcactttcgttgattcgtggatacaattatgtt |
31088497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3413 times since January 2019
Visitors: 4035