View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_low_12 (Length: 373)
Name: NF0628_low_12
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0628_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 118 - 373
Target Start/End: Complemental strand, 48167997 - 48167742
Alignment:
| Q |
118 |
tcccatactcacatctcttgcctacaaaaagtaaagttgcatacataattgagttgaattatatactatataatctagtgtaatttaatgtcatgtaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167997 |
tcccatactcacatctcttgcctacaaaaagtaaagttgcatacataattgagttgaattatatactatataatctagtgtaatttaatgtcatgtaaat |
48167898 |
T |
 |
| Q |
218 |
gagtgaattgtactacctttctggtgagctgatctcttgcatcaagatccaactctatgactttctgtcctgacagaatttgcaaagcaacaattccaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167897 |
gagtgaattgtactacctttctggtgagctgatctcttgcatcaagatccaactctatgactttctgtcctgacagaatttgcaaagcaacaattccaaa |
48167798 |
T |
 |
| Q |
318 |
actatatacatcactggcacaagttaacttggcattactcatgtactctggatcca |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167797 |
actatatacatcactggcacaagttaacttggcattactcatgtactctggatcca |
48167742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University