View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_low_13 (Length: 362)
Name: NF0628_low_13
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0628_low_13 |
 |  |
|
[»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 14561 - 14832
Alignment:
Q |
1 |
ttggcaatgagaagagagcattccatttactgcaatgaatgaccctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14561 |
ttggcaatgagaagagagcattccatttactgcaatgaatgaccctattggacacttgccatagtttcaatgactctcccacccacctctttcctaaatt |
14660 |
T |
 |
Q |
101 |
atgaagttatagcgactagtctttcaacatattggcattatctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgaca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14661 |
atgaagttatagcgactagtctttcaacatattggcattatctgttgctttcttgaaaaattgtgtccagtggaaagctactgaactttggctactgaca |
14760 |
T |
 |
Q |
201 |
taactttgaaagcacaaacatggattataaggacataacggaacagtatatcttatacatgatgatgtccat |
272 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
14761 |
taactttgaaagcacaaacatggattataaggacataacggaacagtatatcttatacatgaggatgaccat |
14832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3445 times since January 2019
Visitors: 4035